Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts

  • tonybolger
    replied
    Originally posted by ebioman View Post
    What does R1_Unpaired contain ?
    The forward reads for which the corresponding reverse read was discarded, for whatever reason. The reason behind this is how most tools interpret paired files - tools often assume that both files contain corresponding reads in the same order. Thus you need somewhere else to put 'singleton' reads which have lost their mate.

    Originally posted by ebioman View Post
    Do I use R1_unpaired as well for the assembly or only R1_paired?
    If the assembler (or other downstream tool) can handle a mix of paired and single end reads, you can use both.

    Originally posted by ebioman View Post
    In the case when no R1_paired is generated, do I use directly R1_unpaired or does this indicate a serious problem ?
    This seems strange - 4 files should always be created (when running trimmomatic in paired-end mode).

    Leave a comment:


  • ebioman
    replied
    Question regarding Paired/Unpaired Output

    I have a question regarding the output files if trimming of paired-ends is chosen.
    To recapitulate:
    4 files are generated:
    • R1_Paired
    • R1_Unpaired
    • R2_Paired
    • R2_Unpaired


    I am confused of the final data these contain and find the manual less helpful.

    E.g. I did a trimming and I analyze with fastqc the original file R1 and R1_Paired. This reports to me that the quality enhanced and I can observe that certain bad reads were discarded.
    1. What does R1_Unpaired contain ?
    2. Do I use R1_unpaired as well for the assembly or only R1_paired?
    3. In the case when no R1_paired is generated, do I use directly R1_unpaired or does this indicate a serious problem ?


    I hope somebody can help solve some of these question

    Leave a comment:


  • tonybolger
    replied
    Originally posted by htetre View Post
    Hello,

    I am trying to use Trimmomatic for the first time and am getting the following error message:

    TrimmomaticPE: Started with arguments: -phred33 /homes/htetre/Illumina06272013/ANN_ACAGTG_L004_R1_001.fastq /homes/htetre/Illumina06272013/ANN_ACAGTG_L004_R2_001.fastq ANN_1_PE.fastq ANN_1_UP.fastq ANN_2_PE.fastq ANN_2_UP.fastq ILLUMINACLIP:/homes/htetre/Trimmomatic-0.30/adapters/TruSeq2-PE.fa

    Exception in thread "main" java.lang.ArrayIndexOutOfBoundsException: 1
    at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer.makeIlluminaClippingTrimmer(IlluminaClippingTrimmer.java:53)
    Hi Hannah,

    It appears you're missing the numeric thresholds used with the ILUMINACLIP step. If you use the suggested values, that step should look like:

    ILLUMINACLIP:/homes/htetre/Trimmomatic-0.30/adapters/TruSeq2-PE.fa:2:30:12

    I really need to improve the error reporting when such problems occur.

    Tony.

    Leave a comment:


  • htetre
    replied
    Below is the head and tail of my file.

    Thanks for taking a look.

    HEAD:
    ANN_ACAGTG_L004_R1_001.fastq <==
    @HWI-ST538:334:C225RACXX:4:1101:1202:1954 1:Y:0:ACAGTG
    ACNTTATGATTTTTGGNNNGTNCNANGNNCAGNGCGGNGCGGGGNNNNNNNNGNAACATAATANNNNNNNNNNNCATGAT AAAAATGNATAACACNCAAT
    +
    <<#25>?@<<@@????################################################################ ####################

    TAIL:
    <=7?A><@A+?AB<BBB3A<<@<ABB@BA<;?A7=A>B90?=:??A><4=*('--=(.8>BBA.7>AAA###############################
    @HWI-ST538:334:C225RACXX:4:2316:21264:100116 1:Y:0:ACAGTG
    TTGTTCTGTCGTAATCTTCAAACGAAGCAATTTGTTTTACCGGAATCCAATTTACCCATATCAACTCCTCGAACGCATTCAAAGTGCTCGACTGAAGCAA
    +
    (5;=?@<@.)@(2<5>8):=8:<35@=(<1@#####################################################################

    Leave a comment:


  • westerman
    replied
    I suspect something wrong with your input files. Could you head and tail 5 lines from each of the files and post it to this forum thread.

    Leave a comment:


  • htetre
    replied
    Hello,

    I am trying to use Trimmomatic for the first time and am getting the following error message:

    TrimmomaticPE: Started with arguments: -phred33 /homes/htetre/Illumina06272013/ANN_ACAGTG_L004_R1_001.fastq /homes/htetre/Illumina06272013/ANN_ACAGTG_L004_R2_001.fastq ANN_1_PE.fastq ANN_1_UP.fastq ANN_2_PE.fastq ANN_2_UP.fastq ILLUMINACLIP:/homes/htetre/Trimmomatic-0.30/adapters/TruSeq2-PE.fa

    Exception in thread "main" java.lang.ArrayIndexOutOfBoundsException: 1
    at org.usadellab.trimmomatic.trim.IlluminaClippingTrimmer.makeIlluminaClippingTrimmer(IlluminaClippingTrimmer.java:53)
    at org.usadellab.trimmomatic.trim.TrimmerFactory.makeTrimmer(TrimmerFactory.java:27)
    at org.usadellab.trimmomatic.TrimmomaticPE.run(TrimmomaticPE.java:344)
    at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:23)

    Can someone help me with this error message?

    Thank you so much for your help
    Hannah

    Leave a comment:


  • fishie
    replied
    per my above question... I did find the Nextera XT adapater sequences, and I understand how to use them for simple clipping for trimmomatic. However, I'm still unclear on exactly what the palindrome clipping is, and whether it is necessary for my MiSeq data (paired reads, 2x250. Note that it is NOT a mate-pair library though). If it is suggested to use palindrome clipping, what should be used for the prefixes?

    Leave a comment:


  • fishie
    replied
    Hi. Sorry I'm generally new to this forum and NGS.

    I'm looking at using trimmomatic to remove adapters and trim my sequences from MiSeq. I used the Nextera XT kit and their primers for my libraries, not the TruSeq kits. Does anyone know if a list of the Nextera adapater and primer sequences is readily available somewhere for use with ILLUMINACLIP?

    Leave a comment:


  • rmdoyle
    replied
    Hi tonybolger,

    Thanks for your help with this, I ended up removing the offensive record and the corresponding paired read. I don't know that this was causing the original problem with corrupted files, but the issue seems to have resolved itself...

    Leave a comment:


  • tonybolger
    replied
    Originally posted by rmdoyle View Post
    Yup, the complete record is:

    @FCB01CWABXX:1:2205:1823:145892
    GAGGTTCTTTGCTTCCTTCGGGAACCTCTCCAGCCCCACTGCCATCCTTGGCAACCCCATGGTCCGTGCCCATGGCAAGAAAGTGCTCAC
    +FCB01CWABXX:1:2205:1823:145892
    ggggggggggggfeggggggggcgggeggggggggeggg18207:146312
    This looks indeed like a dodgy record - the end of the quality score line is missing, and the numeric bit looks like the end of the name from another record.

    Originally posted by rmdoyle View Post
    I suppose I could just cut this record out?
    Perhaps, but i would be rather concerned where it came from. Furthermore, you probably then end up with additional missing records, and you would need to match the other 'paired' file in the dataset.

    Originally posted by rmdoyle View Post
    Interestingly, if I leave out the ILLUMINACLIP:TruSeqForTrimmomatic.fna:2:30:10 option, and leave my code as:

    trimmomatic paired-end -phred64 -trimlog trimlog SRR522907_1.fastq SRR522907_2.fastq paired_output1b.fastq unpaired_output1b.fastq paired_output2b.fastq unpaired_output2b.fastq LEADING:20 TRAILING:20 MINLEN:30

    I get files that I CAN run through fastqc without any problems (the results don't look great, but I can run the files through). Does that set off any red flags?
    This is also very strange. Trimmomatic parses the FASTQ in the same way regardless of the trimming steps selected, so for some reason, it must have seen valid records this time (or at least records which aren't broken in this way).

    I suggest running something like md5sum on the original files on this computer, and on a separate machine, a few times each, to see if there is any inconsistency.

    Leave a comment:


  • rmdoyle
    replied
    Yup, the complete record is:

    @FCB01CWABXX:1:2205:1823:145892
    GAGGTTCTTTGCTTCCTTCGGGAACCTCTCCAGCCCCACTGCCATCCTTGGCAACCCCATGGTCCGTGCCCATGGCAAGAAAGTGCTCAC
    +FCB01CWABXX:1:2205:1823:145892
    ggggggggggggfeggggggggcgggeggggggggeggg18207:146312

    I suppose I could just cut this record out?

    Interestingly, if I leave out the ILLUMINACLIP:TruSeqForTrimmomatic.fna:2:30:10 option, and leave my code as:

    trimmomatic paired-end -phred64 -trimlog trimlog SRR522907_1.fastq SRR522907_2.fastq paired_output1b.fastq unpaired_output1b.fastq paired_output2b.fastq unpaired_output2b.fastq LEADING:20 TRAILING:20 MINLEN:30

    I get files that I CAN run through fastqc without any problems (the results don't look great, but I can run the files through). Does that set off any red flags?

    Leave a comment:


  • tonybolger
    replied
    Originally posted by rmdoyle View Post
    Hmmm... gave it another shot and still no dice. Any thoughts on the following error/warning, tonybolger?

    Exception in thread "main" java.lang.RuntimeException: Sequence and quality length don't match: 'GAGGTTCTTTGCTTCCTTCGGGAACCTCTCCAGCCCCACTGCCATCCTTGGCAACCCCATGGTCCGTGCCCATGGCAAGAAAGTGCTCAC' vs 'ggggggggggggfeggggggggcgggeggggggggeggg
    Ah, that was a trimmomatic error. Normally a FASTQ record should have the same number of bases and quality scores, and for some reason, this read appears to have fewer quality scores, which trimmomatic considers invalid (AFAIK this is correct behaviour). At this point, trimmomatic gives up, and probably leaves a partial output file, which may cause other issues.

    The question is why the record is invalid. Can you find that fastq record within the file?

    Of course, trimmomatic should really log the name of the record as well, rather than just the data, but i haven't seen this happen before.

    Leave a comment:


  • rmdoyle
    replied
    Hmmm... gave it another shot and still no dice. Any thoughts on the following error/warning, tonybolger?

    Exception in thread "main" java.lang.RuntimeException: Sequence and quality length don't match: 'GAGGTTCTTTGCTTCCTTCGGGAACCTCTCCAGCCCCACTGCCATCCTTGGCAACCCCATGGTCCGTGCCCATGGCAAGAAAGTGCTCAC' vs 'ggggggggggggfeggggggggcgggeggggggggeggg

    Leave a comment:


  • tonybolger
    replied
    Originally posted by rmdoyle View Post
    I'd appreciate any thoughts on where I went wrong...
    Very strange indeed, and nothing i've seen before.

    I would suspect something like a lack of disk space, or something killed the trimmomatic process. It may also be a one-off glitch, so perhaps running it again, and checking if the output is still broken might help.

    Leave a comment:


  • rmdoyle
    replied
    Hi everyone,

    I've recently used Trimmomatic on some Illumina HiSeq PE fastq files. I then attempted to run the post-Trimmomatic fastq files through fastqc. My original illumina files run through fastqc just fine, but the post-trimmomatic files get stuck, which makes me think I've corrupted the files somehow while using Trimmomatic.

    When I run fastqc on my post-trimmomatic fastq files, I get the following output after inputting my sequences:

    Exception in thread "Thread-4" java.lang.NullPointerException
    at uk.ac.babraham.FastQC.Sequence.FastQFile.readNext(FastQFile.java:141)
    at uk.ac.babraham.FastQC.Sequence.FastQFile.next(FastQFile.java:105)
    at uk.ac.babraham.FastQC.Analysis.AnalysisRunner.run(AnalysisRunner.java:76)
    at java.lang.Thread.run(Unknown Source)

    I also did get one error message after running trimmomatic. This error was:

    Exception in thread "main" java.lang.RuntimeException: Sequence and quality length don't match: 'GAGGTTCTTTGCTTCCTTCGGGAACCTCTCCAGCCCCACTGCCATCCTTGGCAACCCCATGGTCCGTGCCCATGGCAAGAAAGTGCTCAC' vs 'ggggggggggggfeggggggggcgggeggggggggeggg

    My original trimmomatic code was:

    TrimmomaticPE: -phred64 -trimlog trimlog SRR522907_1.fastq SRR522907_2.fastq paired_output1.fastq unpaired_output1.fastq paired_output2.fastq unpaired_output2.fastq ILLUMINACLIP:TruSeq3_PE.fa:2:30:10 LEADING:20 TRAILING:20 MINLEN:30

    I'd appreciate any thoughts on where I went wrong...

    Leave a comment:

Latest Articles

Collapse

  • SEQadmin2
    How Immunogenomics Decodes Immunity’s Genetic Blueprint
    by SEQadmin2




    The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

    This convergence of genetics, immunology, and computation...
    09-01-2026, 05:41 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, Yesterday, 10:22 AM
0 responses
10 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 09-02-2026, 12:32 PM
0 responses
14 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-24-2026, 10:32 AM
0 responses
49 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-20-2026, 11:17 AM
0 responses
51 views
0 reactions
Last Post SEQadmin2  
Working...