unique hits

[arrchi]

Hi there,

I am looking for a way to find unique hits for my RNA-seq data. After searching online and in this community, I still can't find a good way to find unique hits from a sam file. Any input will be welcome.

I used tophat to align the data to the HG19 and samtools -bq -1 to generated reliable hits.

Here is part of the output:

[Tophat_out]$ grep -w SRR087416.97659 accepted_hits_realiable.sam
SRR087416.97659 0 chr1 11356 1 36M * 0 0 CAGCTAGGGACATTGCAGGGTCCTCTTGCTCAAGGT BBBCBCB9CBBBC@:+>3A97AACABA9@CCCCB9# NM:i:0 NH:i:4 CC:Z:chr12 CP:i:94218
SRR087416.97659 16 chr12 94218 1 36M * 0 0 ACCTTGAGCAAGAGGACCCTGCAATGTCCCTAGCTG #9BCCCC@9ABACAA79A3>+:@CBBBC9BCBCBBB NM:i:0 NH:i:4 CC:Z:chr15 CP:i:102519779
SRR087416.97659 16 chr15 102519779 1 36M * 0 0 ACCTTGAGCAAGAGGACCCTGCAATGTCCCTAGCTG #9BCCCC@9ABACAA79A3>+:@CBBBC9BCBCBBB NM:i:0 NH:i:4 CC:Z:chr2 CP:i:114359624

My questions are: Does this mean that the read SRR087416.97659 maps to chr1, chr12, and chr15?

If I understand the concept "unique-hit" correctly, then this read can not be counted as an unique hit. Am I right?

Thanks,

-A

[rnaeye]

Hi there,

I am looking for a way to find unique hits for my RNA-seq data. After searching online and in this community, I still can't find a good way to find unique hits from a sam file. Any input will be welcome.

I used tophat to align the data to the HG19 and samtools -bq -1 to generated reliable hits.

Here is part of the output:

[Tophat_out]$ grep -w SRR087416.97659 accepted_hits_realiable.sam
SRR087416.97659 0 chr1 11356 1 36M * 0 0 CAGCTAGGGACATTGCAGGGTCCTCTTGCTCAAGGT BBBCBCB9CBBBC@:+>3A97AACABA9@CCCCB9# NM:i:0 NH:i:4 CC:Z:chr12 CP:i:94218
SRR087416.97659 16 chr12 94218 1 36M * 0 0 ACCTTGAGCAAGAGGACCCTGCAATGTCCCTAGCTG #9BCCCC@9ABACAA79A3>+:@CBBBC9BCBCBBB NM:i:0 NH:i:4 CC:Z:chr15 CP:i:102519779
SRR087416.97659 16 chr15 102519779 1 36M * 0 0 ACCTTGAGCAAGAGGACCCTGCAATGTCCCTAGCTG #9BCCCC@9ABACAA79A3>+:@CBBBC9BCBCBBB NM:i:0 NH:i:4 CC:Z:chr2 CP:i:114359624

My questions are: Does this mean that the read SRR087416.97659 maps to chr1, chr12, and chr15?

If I understand the concept "unique-hit" correctly, then this read can not be counted as an unique hit. Am I right?

Thanks,

-A

You are correct: SRR087416.97659 sequence maps more than one location in the genome. This means that you have no way of knowing where that sequence is coming from. You need to sort your output by sequence ID, then find uniq IDs. Does this help? Unique read should hit the genome only once at one specific location.

[rnaeye]

btw, what instrumentation this output is coming from? Thanks.

[arrchi]

Thanks for your message.

The result is generated by a Mac Pro with 8GB Memory and 1TB hard drive. Is that you want to know?

[rnaeye]

my questions was what DNA sequencing platform this output is from, such as Illumina, ABI SOLiD, etc. thanks.

[arrchi]

Oh. Sorry.

This is Illumina RNA sequencing data.

[arrchi]

Does anybody knows that the value 0 in "SRR087416.97659 0" means? I checked samtools menu, it only says if 0x1 is unset, no assumptions can be made about .....

[arrchi]

I found an old post saying that

Flag 0 means "the read is not paired and mapped, forward strand".

Hope it is true.