Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • finfin
    Junior Member
    • Dec 2011
    • 8

    SAM alignment result: match without reference report

    Hi,

    I used novoalign to map some sequence and got this kind of result in SAM format:

    SRR2002 0 * 175710298 0 23M13H * 0 0 CAATTGTCAGAGGTGAAATTCTT B>7<?99@:9<=:;569=>B@=@ PG:Z:novoalign AS:i:55 UQ:i:55 NM:i:2 MD:Z:15G0C6

    It is mapped to the genome, with the match start, strand, even the mismatches are reported. However, the third column, where should be "chrN" turned out to be a star.

    Any one encountered this situation? Could any body kindly tell me why this happened?

    Thanks in advance!

Latest Articles

Collapse

  • GATTACAT
    Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by GATTACAT
    Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
    Yesterday, 11:43 AM
  • SEQadmin2
    Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by SEQadmin2


    I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

    Here are nine questions we think about, in roughly the order they matter, before...
    06-18-2026, 07:11 AM
  • SEQadmin2
    From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
    by SEQadmin2


    Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


    The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
    ...
    06-02-2026, 10:05 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 06-30-2026, 05:37 AM
0 responses
9 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-26-2026, 11:10 AM
0 responses
18 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-17-2026, 06:09 AM
0 responses
52 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-09-2026, 11:58 AM
0 responses
110 views
0 reactions
Last Post SEQadmin2  
Working...