Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • How to submit Illimina fastq to SRA?

    Hi all,

    Does the anybody have experience in Illumina data submission to the Short Read Archive (http://www.ncbi.nlm.nih.gov/Traces/sra)? After reading official documentation (http://www.ncbi.nlm.nih.gov/Traces/s...Guidelines.pdf), I still don't know how to.
    I've already created study, experiment and run through the web interface, but I don't know how to upload my read data and link it to the study or run?

    Thank you!

  • #2
    If the data is RNA-seq data, then I would recommend creating a GEO submission instead. Then GEO's pipeline automatically creates an SRA submission for you. In my opinion, their instructions and website are more user friendly.

    Comment


    • #3
      Originally posted by malachig View Post
      If the data is RNA-seq data, then I would recommend creating a GEO submission instead. Then GEO's pipeline automatically creates an SRA submission for you. In my opinion, their instructions and website are more user friendly.
      Thank you Malachig. My data is not RNA-seq data, but like that. I mailto the SRA yesterday, now I probably know how to do this but haven't tried yet. The rough steps: First create a RUN module through SRA website, then mailto SRA to ask for a FTP password and upload the data to FTP (not compressed), then they will process the data and update the info for your submission.

      Comment


      • #4
        Hi, I found the european ERA staff at the EBI to be very helpful. They had pretty good documentation too, but you need to email the staff there first who provide you with the relevant files, as the style sheets you can download are confusing.

        Good luck

        Comment


        • #5
          Originally posted by colindaven View Post
          Hi, I found the european ERA staff at the EBI to be very helpful. They had pretty good documentation too, but you need to email the staff there first who provide you with the relevant files, as the style sheets you can download are confusing.

          Good luck
          Thank you colindaven! I emailed just now, hope it works.

          And, I also tried upload the data to FTP, and the SRA did process my reads but error ocurred:

          data-load: run file problems data inconsistent - length of reads found do not match experiment: ''HWUSI-EAS1571_0012:8:1:1017:20197'' data inconsistent - failed to load data with interface version 1.0
          2010-09-23 09:06:02 data-load: run file problems
          data-load: run file problems
          data inconsistent - length of reads found do not match experiment: ''HWUSI-EAS1571_0012:8:1:1017:20197''
          data inconsistent - failed to load data with interface version 1.0

          my read is like this:
          @HWUSI-EAS1571_0012:8:61:19449:1260#0/1
          GAACGTCATGAACGCAGAGTGGCCTTGCTGCCACGATCCACTGAGATTCAGCCCTTTGTCGCTAAGATTCGG
          +HWUSI-EAS1571_0012:8:61:19449:1260#0/1
          eeffffffeafffffcefffedfff^cdddeeec`ddddddb`d^`Y`a`bcdda__b]b_cL^Y_Y_^^^_

          Maybe I wrote the "flowcell" and "lane" wrongly (as attached). What's the flowcell? (I just know the sequence but know little about the sequencing) From the read header (@HWUSI-EAS1571_0012:8:61:19449:1260#0/1), I think lane=8.
          Attached Files

          Comment


          • #6
            Originally posted by xhuister View Post
            Thank you Malachig. My data is not RNA-seq data, but like that. I mailto the SRA yesterday, now I probably know how to do this but haven't tried yet. The rough steps: First create a RUN module through SRA website, then mailto SRA to ask for a FTP password and upload the data to FTP (not compressed), then they will process the data and update the info for your submission.
            Hi xhuister,

            so I try to send my reads to the SRA but I have some problem. I make project, sample, experiment and RUN. In the last page of run submission they give me a password and an id for ftp private up-load of my data. I've some problem on up-loading data using FTP. I use ncftp for ubuntu, but it seems it does not works.
            Have you some suggestion?

            Comment


            • #7
              xhuister, check your read lengths. That is what the error message seems to be indicating. You could also try entering the flowcell as "Illumina:@HWUSI-EAS1571_0012". That is the format I used and it worked.

              Ariani_Andrea, try regular "ftp". I have not used ncftp, but I know sftp did not work.

              Comment


              • #8
                SRA errors uploading fastq files

                Hi all,

                I was trying to upload several human exomes (fastq files) to SRA but I have several problems and I couldn't obtain and answer from sra so I would like to ask if anybody had the same errors.
                I used the SRA submission portal and when I completed all the submission steps I got the following error for several files:
                XXX_2.fastq:39969:31:syntax error, unexpected '@', expecting fqENDLINE

                I detected that some of the fastq files were created with a different sequencing software which add an extra @ after the multiplexing index in the read names. I removed all these characters and now I got for some files the error:

                ile ouudru8m/XXX.fq.gz is not recognized by SP

                It seems a problem with the server remote folder (it seems that creates temporal folders as ouudru8m) but I cannot obtain an answer from the sra team and I don't know how to deal with this error. Someone had this problem?

                I used the ascp command line tool in order to upload all the files to he remote sra folder.

                Thank you very much

                Comment

                Latest Articles

                Collapse

                • seqadmin
                  Essential Discoveries and Tools in Epitranscriptomics
                  by seqadmin




                  The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
                  04-22-2024, 07:01 AM
                • seqadmin
                  Current Approaches to Protein Sequencing
                  by seqadmin


                  Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
                  04-04-2024, 04:25 PM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by seqadmin, 04-25-2024, 11:49 AM
                0 responses
                19 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 04-24-2024, 08:47 AM
                0 responses
                18 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 04-11-2024, 12:08 PM
                0 responses
                62 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 04-10-2024, 10:19 PM
                0 responses
                60 views
                0 likes
                Last Post seqadmin  
                Working...
                X