MiRPara a new tool for miRNA

[Jayu]

hello has anyone worked with MiRPara?

[weasteam]

yes, let me know if you have any questions.

[Jayu]

This tool is not working online as i have taken many sequences from mirbase but it is not giving result only the example which is given on the site is giving result.Please can u help me out with this.

[weasteam]

Really?
I randomly selected one sequence from mirbase and it works.
>rno-mir-216a MI0000955
GUUAGCUAUGAGUUAGUUUAAUCUCAGCUGGCAACUGUGAGAUGUCCCUAUCAUUCCUCACAGUGGUCUCUGGGAUUAUGCUAAACAGAGCAAUUUCCUUGACCUC

It is possible that the sequences you selected would result in no result, because
1) miRPara's accuracy is ~80%
2) not all miRNAs from miRBase is correct miRNAs.

[Jayu]

ok thanks.but have you used its standalone version?

[weasteam]

ok thanks.but have you used its standalone version?

Yes, this is better, I can predict for whole viruses geneomes.

[eng_sheringokhy]

hello has anyone worked with MiRPara?

Hi Itried to work with the standalone miRPara4.1 on linux fedora
I follow the download instructions and when i run the code I got the following message
[root@localhost miRPara4.1]# perl miRPara.pl seq.fasta
Checking for UNAFold.p... found
Checking for ct2out... found
Use of uninitialized value $title in concatenation (.) or string at miRPara.pl line 272.
RNAFolding for _1_393...sh: /usr/local/bin/ct2out: No such file or directory
done

All Done.
Use of uninitialized value in null operation during global destruction.
also I have an output file with only the print statements without any classification results may u help me

[weasteam]

Hi Itried to work with the standalone miRPara4.1 on linux fedora
I follow the download instructions and when i run the code I got the following message
[root@localhost miRPara4.1]# perl miRPara.pl seq.fasta
Checking for UNAFold.p... found
Checking for ct2out... found
Use of uninitialized value $title in concatenation (.) or string at miRPara.pl line 272.
RNAFolding for _1_393...sh: /usr/local/bin/ct2out: No such file or directory
done

All Done.
Use of uninitialized value in null operation during global destruction.
also I have an output file with only the print statements without any classification results may u help me

hi, have you installed ct2out? if yes, did you copy this file to the /usr/local/bin/?

[eng_sheringokhy]

yes I did
I have the same result

[weasteam]

Do you mind sent the sequence to me? I can debug the miRPara and solve the problem for you.

[eng_sheringokhy]

Do you mind sent the sequence to me? I can debug the miRPara and solve the problem for you.

thank you so much
may you send me your Email
>hsa-let-7a-1 MI0000060

UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA

>hsa-let-7a-2 MI0000061

AGGUUGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCU

>hsa-let-7a-3 MI0000062

GGGUGAGGUAGUAGGUUGUAUAGUUUGGGGCUCUGCCCUGCUAUGGGAUAACUAUACAAUCUACUGUCUUUCCU

>hsa-let-7b MI0000063

CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAUGUUGCCCCUCGGAAGAUAACUAUACAACCUACUGCCUUCCCUG

>hsa-let-7c MI0000064

GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGC

[weasteam]

thank you so much
may you send me your Email
>hsa-let-7a-1 MI0000060

UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA

>hsa-let-7a-2 MI0000061

AGGUUGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCU

>hsa-let-7a-3 MI0000062

GGGUGAGGUAGUAGGUUGUAUAGUUUGGGGCUCUGCCCUGCUAUGGGAUAACUAUACAAUCUACUGUCUUUCCU

>hsa-let-7b MI0000063

CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAUGUUGCCCCUCGGAAGAUAACUAUACAACCUACUGCCUUCCCUG

>hsa-let-7c MI0000064

GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGC

Sorry, I did not notice your reply. please download the most updated miRPara, miRPara4.2 at http://www.whiov.ac.cn/bioinformatics/mirpara or http://code.google.com/p/mirpara/downloads/list, it should fix the bug.