Tweet
hello has anyone worked with MiRPara?
-
-
yes, let me know if you have any questions. -
This tool is not working online as i have taken many sequences from mirbase but it is not giving result only the example which is given on the site is giving result.Please can u help me out with this.Comment
-
Really?
I randomly selected one sequence from mirbase and it works.
>rno-mir-216a MI0000955
GUUAGCUAUGAGUUAGUUUAAUCUCAGCUGGCAACUGUGAGAUGUCCCUAUCAUUCCUCACAGUGGUCUCUGGGAUUAUGCUAAACAGAGCAAUUUCCUUGACCUC
It is possible that the sequences you selected would result in no result, because
1) miRPara's accuracy is ~80%
2) not all miRNAs from miRBase is correct miRNAs.Comment
-
ok thanks.but have you used its standalone version?Comment
-
Yes, this is better, I can predict for whole viruses geneomes.Originally posted by Jayu View PostComment
-
Hi Itried to work with the standalone miRPara4.1 on linux fedoraOriginally posted by Jayu View Post
I follow the download instructions and when i run the code I got the following message
[root@localhost miRPara4.1]# perl miRPara.pl seq.fasta
Checking for UNAFold.p... found
Checking for ct2out... found
Use of uninitialized value $title in concatenation (.) or string at miRPara.pl line 272.
RNAFolding for _1_393...sh: /usr/local/bin/ct2out: No such file or directory
done
All Done.
Use of uninitialized value in null operation during global destruction.
also I have an output file with only the print statements without any classification results may u help meComment
-
Originally posted by eng_sheringokhy View Post
hi, have you installed ct2out? if yes, did you copy this file to the /usr/local/bin/?Comment
-
yes I did
I have the same resultComment
-
Do you mind sent the sequence to me? I can debug the miRPara and solve the problem for you.Comment
-
thank you so muchOriginally posted by weasteam View Post
may you send me your Email
>hsa-let-7a-1 MI0000060
UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA
>hsa-let-7a-2 MI0000061
AGGUUGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCU
>hsa-let-7a-3 MI0000062
GGGUGAGGUAGUAGGUUGUAUAGUUUGGGGCUCUGCCCUGCUAUGGGAUAACUAUACAAUCUACUGUCUUUCCU
>hsa-let-7b MI0000063
CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAUGUUGCCCCUCGGAAGAUAACUAUACAACCUACUGCCUUCCCUG
>hsa-let-7c MI0000064
GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGCLast edited by eng_sheringokhy; 06-08-2012, 10:54 AM.Comment
-
Sorry, I did not notice your reply. please download the most updated miRPara, miRPara4.2 at http://www.whiov.ac.cn/bioinformatics/mirpara or http://code.google.com/p/mirpara/downloads/list, it should fix the bug.Originally posted by eng_sheringokhy View PostComment
-
Kheloyar – Everything You Need to Know About Kheloyaar Login and Kheoyar Id
If you are looking for an online gaming platform that offers a user-friendly experience, Kheloyar has become a name that many users search for. Whether you're interested in creating a new account, accessing your dashboard through Kheloyaar Login, or learning how to obtain a Kheoyar Id, understanding the platform's features and account process is essential.
This guide explains everything you need to know about...Yesterday, 01:13 AM -
Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
...07-09-2026, 11:10 AM -
Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.
There is no single reason why many patients don’t respond to treatment as expected. Cancer is...07-08-2026, 05:17 AM
Comment