Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • MiRPara a new tool for miRNA

    hello has anyone worked with MiRPara?

  • #2
    yes, let me know if you have any questions.

    Comment


    • #3
      This tool is not working online as i have taken many sequences from mirbase but it is not giving result only the example which is given on the site is giving result.Please can u help me out with this.

      Comment


      • #4
        Really?
        I randomly selected one sequence from mirbase and it works.
        >rno-mir-216a MI0000955
        GUUAGCUAUGAGUUAGUUUAAUCUCAGCUGGCAACUGUGAGAUGUCCCUAUCAUUCCUCACAGUGGUCUCUGGGAUUAUGCUAAACAGAGCAAUUUCCUUGACCUC

        It is possible that the sequences you selected would result in no result, because
        1) miRPara's accuracy is ~80%
        2) not all miRNAs from miRBase is correct miRNAs.

        Comment


        • #5
          ok thanks.but have you used its standalone version?

          Comment


          • #6
            Originally posted by Jayu View Post
            ok thanks.but have you used its standalone version?
            Yes, this is better, I can predict for whole viruses geneomes.

            Comment


            • #7
              Originally posted by Jayu View Post
              hello has anyone worked with MiRPara?
              Hi Itried to work with the standalone miRPara4.1 on linux fedora
              I follow the download instructions and when i run the code I got the following message
              [root@localhost miRPara4.1]# perl miRPara.pl seq.fasta
              Checking for UNAFold.p... found
              Checking for ct2out... found
              Use of uninitialized value $title in concatenation (.) or string at miRPara.pl line 272.
              RNAFolding for _1_393...sh: /usr/local/bin/ct2out: No such file or directory
              done

              All Done.
              Use of uninitialized value in null operation during global destruction.
              also I have an output file with only the print statements without any classification results may u help me

              Comment


              • #8
                Originally posted by eng_sheringokhy View Post
                Hi Itried to work with the standalone miRPara4.1 on linux fedora
                I follow the download instructions and when i run the code I got the following message
                [root@localhost miRPara4.1]# perl miRPara.pl seq.fasta
                Checking for UNAFold.p... found
                Checking for ct2out... found
                Use of uninitialized value $title in concatenation (.) or string at miRPara.pl line 272.
                RNAFolding for _1_393...sh: /usr/local/bin/ct2out: No such file or directory
                done

                All Done.
                Use of uninitialized value in null operation during global destruction.
                also I have an output file with only the print statements without any classification results may u help me

                hi, have you installed ct2out? if yes, did you copy this file to the /usr/local/bin/?

                Comment


                • #9
                  yes I did
                  I have the same result

                  Comment


                  • #10
                    Do you mind sent the sequence to me? I can debug the miRPara and solve the problem for you.

                    Comment


                    • #11
                      Originally posted by weasteam View Post
                      Do you mind sent the sequence to me? I can debug the miRPara and solve the problem for you.
                      thank you so much
                      may you send me your Email
                      >hsa-let-7a-1 MI0000060

                      UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA

                      >hsa-let-7a-2 MI0000061

                      AGGUUGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCU

                      >hsa-let-7a-3 MI0000062

                      GGGUGAGGUAGUAGGUUGUAUAGUUUGGGGCUCUGCCCUGCUAUGGGAUAACUAUACAAUCUACUGUCUUUCCU

                      >hsa-let-7b MI0000063

                      CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAUGUUGCCCCUCGGAAGAUAACUAUACAACCUACUGCCUUCCCUG

                      >hsa-let-7c MI0000064

                      GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGC
                      Last edited by eng_sheringokhy; 06-08-2012, 10:54 AM.

                      Comment


                      • #12
                        Originally posted by eng_sheringokhy View Post
                        thank you so much
                        may you send me your Email
                        >hsa-let-7a-1 MI0000060

                        UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA

                        >hsa-let-7a-2 MI0000061

                        AGGUUGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCU

                        >hsa-let-7a-3 MI0000062

                        GGGUGAGGUAGUAGGUUGUAUAGUUUGGGGCUCUGCCCUGCUAUGGGAUAACUAUACAAUCUACUGUCUUUCCU

                        >hsa-let-7b MI0000063

                        CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAUGUUGCCCCUCGGAAGAUAACUAUACAACCUACUGCCUUCCCUG

                        >hsa-let-7c MI0000064

                        GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGC
                        Sorry, I did not notice your reply. please download the most updated miRPara, miRPara4.2 at http://www.whiov.ac.cn/bioinformatics/mirpara or http://code.google.com/p/mirpara/downloads/list, it should fix the bug.

                        Comment

                        Latest Articles

                        Collapse

                        • seqadmin
                          Latest Developments in Precision Medicine
                          by seqadmin



                          Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

                          Somatic Genomics
                          “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
                          05-24-2024, 01:16 PM
                        • seqadmin
                          Recent Advances in Sequencing Analysis Tools
                          by seqadmin


                          The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
                          05-06-2024, 07:48 AM

                        ad_right_rmr

                        Collapse

                        News

                        Collapse

                        Topics Statistics Last Post
                        Started by seqadmin, 05-24-2024, 07:15 AM
                        0 responses
                        13 views
                        0 likes
                        Last Post seqadmin  
                        Started by seqadmin, 05-23-2024, 10:28 AM
                        0 responses
                        17 views
                        0 likes
                        Last Post seqadmin  
                        Started by seqadmin, 05-23-2024, 07:35 AM
                        0 responses
                        20 views
                        0 likes
                        Last Post seqadmin  
                        Started by seqadmin, 05-22-2024, 02:06 PM
                        0 responses
                        10 views
                        0 likes
                        Last Post seqadmin  
                        Working...
                        X