For those people following this thread.
We are recruiting Post-Doctoral Fellows for one of our large cancer genomics programs. If you are interested in working in a cutting edge research institute focused on translational genomics and leading a major project please send a cover letter and CV to Dr Keats. (www.keatslab.org)(www.tgen.org)
-
Its been a very long time since I've updated this thread. I've recently added a couple of new MAC computers that I use for development and tertiary analysis. And I wanted an updated build protocol to install all the different applications we have outlined in earlier versions of this thread. If you want to see the updated build instructions they are available on my lab website (http://www.keatslab.org/computation/...ure-a-machine1)Leave a comment:
-
Create a separate post too otherwise it may not be noticed by people who are looking for a tool like this. Someone had a recent post with just this question.Originally posted by Jon_Keats View PostSomatic Variant Calling
This is a bit of a shameless plug for one of our institutional tools developed for somatic variant calling. In our experience it is one of the best tools for paired tumor-normal/constitutional identification of somatic variants.
Check it out:
On other notes, we have been doing a decent bit of testing comparing Tophat and STAR for RNA alignments. We should be posting more in the future but here are my take aways
1) Using updated genomes and GTF dramatically improves the TOPHAT alignment rates (we moved to the new 1000G reference hs37d5 from the inital version and from ensembl 64 to ensembl 70)
2) STAR is smoking fast
3) STAR does a much better job of aligning indels, particularly large indels (this might be a tophat settings issue, it doesn't seem that we really leverage the bowtie2 gapped alignments in tophat... I could be wrong)
4) Expression estimates of same samples aligned with STAR or TOPHAT are nearly identical (r2>0.97)Leave a comment:
-
Somatic Variant Calling
This is a bit of a shameless plug for one of our institutional tools developed for somatic variant calling. In our experience it is one of the best tools for paired tumor-normal/constitutional identification of somatic variants.
Check it out:
On other notes, we have been doing a decent bit of testing comparing Tophat and STAR for RNA alignments. We should be posting more in the future but here are my take aways
1) Using updated genomes and GTF dramatically improves the TOPHAT alignment rates (we moved to the new 1000G reference hs37d5 from the inital version and from ensembl 64 to ensembl 70)
2) STAR is smoking fast
3) STAR does a much better job of aligning indels, particularly large indels (this might be a tophat settings issue, it doesn't seem that we really leverage the bowtie2 gapped alignments in tophat... I could be wrong)
4) Expression estimates of same samples aligned with STAR or TOPHAT are nearly identical (r2>0.97)Leave a comment:
-
HI JOn,
have you ever used cummeRbund?I am new to R, linux and everything that is not windows...I like your posts and was wondering if you could dispense with some usefull commands...
best,
ireneLeave a comment:
-
Hello everyone its been a very long time since I updated this thread. Over the last year I've had people in my lab maintain a detail protocol on how to build up a new machine to do most NGS analysis, well at least those we do in my group. So thanks to David and Teja we have a pretty comprehensive instruction set. Sadly, some are already a bit out of data and I'll try to have a test done on the next machin in our lab and update as needed.
FULL INSTRUCTION LIST: How To Transform Your Mac Into A Sequencing Analysis Machine
Introduction
I’m a newly hired RA from Jonathan Keats’s lab who will be helping with a bunch of new sequencing stuff. I have been working on installing the suite of sequencing programs on our new workstation. Before I started, I knew virtually nothing about Terminal, Unix or manipulating sequencing files when I started. (In my mind, Terminal was where you board trains and Unix was some Talaxian from Star Trek: Voyager.) The learning curve has been steep, obviously, but Jonathan’s previous posts have been invaluable in making the adjustment.
I wanted to update those posts, however, because (a) some of the instructions have changed as newer versions of applications have appeared; (b) posts could be combined into one gigantic “master-post”; (c) some of the instructions are much more advanced/complicated than others; and (d) some helpful instructions for certain applications weren’t included.
To make things easier on the next bright-eyed generation of programming-illiterate biologists, I have included specific code instructions at practically every step of the installation process. After a couple times mentioning a particular command, I will stop including it to save space, so if you’re starting from the middle of the instruction set, refer to previous instructions for more information.
If you find this compilation of instructions frustratingly simplistic, then I suggest you read through the previous posts, if only to read through Jonathan’s wry comments about the entire bioinformatics process. Hopefully, this post will be helpful to extreme sequencing/Unix novices like myself.
Please let me know if you have any questions, good luck, and happy hunting!
David K. Edwards V and Jonathan Keats
Before You Begin: Programs
Unix
Before you begin, you should familiarize yourself with Terminal (Applications>Utilities>Terminal). Or better yet, you should invest some time working though the Unix portion of the "Unix and Perl for Biologists" course (http://groups.google.com/group/unix-...for-biologists), made public by Keith Bradham and Ian Korf at UC Davis. Or preorder their book on Amazon: http://www.amazon.com/UNIX-Perl-Resc...0189572&sr=8-1. Tell your PI it will be the best $50 investment of their career!
It’s really helpful for beginners understanding non-GUI file manipulations and gives you a good list of important Unix commands. (If you’re completely new to programming, it might be too confusing or complicated, but nobody said this was going to be easy.)
Download the entire course package: http://korflab.ucdavis.edu/Unix_and_Perl/index.html.
Here is a general list of helpful Unix commands:- To get a manual on any command, type "man command". Type "space" to page down, "b" to back-up, and "q" to quit.
- To see what folder you are in currently, type "pwd".
- To see what folders and files exist in the current directory, type "ls".
- To move into a folder in the current directory, type "cd myfolder". (Note: You can move multiple levels downstream with "cd myfolder/myfolder2".)
- To go back one directory, type "cd ..". (Note: You can move back multiple levels upstream with "cd ../..".)
- To copy a file from the current directory to a downstream folder, type "cp myfile myfolder/". (Note: You can copy a file up one directory with "cp myfile ../".)
- To move a file from the current directory, type "mv" instead of typing “cp”.
- A folder immediately downstream of the root directory (i.e. absolute top of the tree) is always defined by "command /folder". (This means if you type "cd /something", it looks for the folder "something" downstream of the root directory.)
- To note the current directory, type ".".
- To change the permissions of the compiled applications, type "chmod 755 myfile". (This makes the file readable and executable by everyone but only writable by you. To allow everybody to do everything to the file, type “chmod 777 myfile”.)
- To become a super user for a particular command (and become Superman!), type “sudo”.
- To decompress a tarball file, type “tar -xvzf file.tar.gz”, where “file.tar.gz” is the decompressed file.
Xcode (http://developer.apple.com/technolog...ols/xcode.html)
NOTE: For some reason Apple has decided to mess with you and recent versions of Xcode (OS Lion and OS Mountain Lion compatible versions) no longer install some essential command line commands like "make" which you will use extensively to build the applications. However, there is an extremely simple solution to install these applications from within Xcode.
To install command line tools see (http://slashusr.wordpress.com/2012/0...nd-line-tools/)- Launch Xcode
- Go to Preferences
- Go to Downloads
- Click the "Command Line Tools" radio button
- Follow Prompts
You need to install Xcode on your computer so you can compile the various applications and if you start writing your own scripts it is a nice text editor in our opinion.
The newest version available on the App store, Xcode 4.3, is only compatible with OSX Mountain Lion (10.8.x). If you have Leopard (10.5.x) or Snow Leopard (10.6.x) or Lion (10.7.x), then you can install the package from your OS installation disks. Insert Mac OS X Install Disc 2, open the “Xcode Tools” folder, and double click “XCodeTools.mpkg”. Otherwise, you need to sign up to be a developer and download it from the website.
MacPorts (http://www.macports.org/)
You need to install some packages to run certain applications. There are two programs to install those packages, Fink and MacPorts. There isn’t much difference between both programs; in general, Fink is more conservative about upgrading packages that MacPorts, but both are perfectly acceptable. I simply chose MacPorts for this protocol.
R and Bioconductor
R: You will need R to perform statistical computations and generate graphs from your data. To install, visit http://www.r-project.org/, then select preferred CRAN mirror and follow the instructions.
Bioconductor: You will probably need Bioconductor to analyze your high-throughput genomic data. To install Bioconductor, you must have the most recent release version of R. The most common packages you will need to install are affy, simpleaffy, and gcmra.
To install these packages, starting first with affy, simply start R and type in the following:
Press enter. R will automatically install the dependencies ‘Biobase’, ‘affyio’, and ‘preprocessCore’ during this installation.Code:source("http://bioconductor.org/biocLite.R") biocLite("affy")
To install simplaffy, replace “affy” with “simplaffy” in the above code and press enter. R will automatically install the dependencies ‘DBI’, ‘RSQLite’, ‘xtable’, ‘IRanges’, ‘AnnotationDbi’, ‘annotate’, ‘Biostrings’, ‘genefilter’, and ‘gcrma’.
There are three other dependencies you should install:
- DESeq: Follow instructions above and type in “DESeq”. (For more information, please visit: http://www-huber.embl.de/users/anders/DESeq/.)
- edgeR: Follow instructions above and type in “edgeR”. (For more information, please visit: http://www.bioconductor.org/packages...tml/edgeR.html.)
- CummeRbund: Follow instructions above and type in “cummeRbund”.
(NOTE: The version of cummeRbund that is installed through the current BioConductor development version is 1.0.0. The latest version, version 1.1.3 will be available as part of the Bioconductor development version 2.10, which will be made available in April 2012. For more information, please visit: http://compbio.mit.edu/cummeRbund/index.html.)
For more installation instructions, visit http://www.bioconductor.org/install/. (For this protocol, the current release version of R is 2.14, and the currently released Bioconductor version is 2.9.)
Before You Begin: Folders
You should establish a series of folders to manage your sequencing data and move around after each step is completed. You don’t necessarily have to follow this system of folders and subfolders, but all of our instructions for installing programs are based on this file hierarchy, so if you want to avoid confusion, and jump on our awesome folder-managing bandwagon, then read carefully!
Here is our system of folders and subfolders:
We have a main working directory called "ngs" in our $HOME directory (Users/YourUserName/). This is our home base for data analysis, and all of our steps and scripts will be called from this folder. Here are our subfolders within “ngs”:
- ngs/{applications,bwa,run_parameters,run_parameters,scripts,temp,tophat,tophat_fusion}
- ngs/analyzed_read_files/{chipseq,exomes,genomes,matepair,rnaseq}
- ngs/finaloutputs/{chipseq,exomes,genomes,matepair,rnaseq}
- ngs/refgenomes/{bfast_indexed,bowtie_indexed,bwa_indexed,downloads}
- ngs/refgenomes/downloads/{ncbi36_hg18,grch37_hg19}
- ngs/refgenomes/downloads/ncbi36_hg18/{annotation_files,reference_sequences}
- ngs/refgenomes/downloads/grch37_hg19/{annotation_files,reference_sequences}
Each of these subfolders have subfolders, so instead of listing everything here, please visit the script “create_ngs_directorystructure_v4.sh” (http://seqanswers.com/forums/showthr...?t=4589&page=4, post #61) for more information. (To run the script, simply copy and paste the code included in that post when you immediately start Terminal, or when you are in the home directory. The corresponding files and folders will be created.)
Before You Begin: Picking Genome Files
[Maq is no longer included in this protocol because of recent improvements to BWA. If you need to install Maq, please see Jon’s preceding post on how to install it.]
This step is important and can be the source of most issues. You need to pick a source for all information genome sequence files and annotations. We use ensembl over UCSC for many reasons. For human genome reference files, we recommend the 1000 genomes versions. They think about the human genome much more than you do, so give them some credit. Besides, many of the applications you will use are published by those groups, so running them is streamlined and less complicated.
We will be using BWA to align our sequencing data against the reference genome (see BWA installation instructions under “Installing Programs”). You might think to use ensembl (http://www.ensembl.org/info/data/ftp/index.html) to get your reference genome, but the full human genome file (Homo_sapiens.GRCh37.66.dna_rm.toplevel.fa.gz) exceeds the maximum character length allowed by BWA’s index command.
Instead, you should use the 1000 Genomes reference genome (ftp://ftp.sanger.ac.uk/pub/1000genom...ect_reference/). You need to save the reference genome onto your computer:
- Copy the file human_g1k_v37.fasta.gz” to your “ngs/refgenomes” folder.
- Decompress the file by double clicking on it.
Installing Applications
Welcome to the meat-and-potatoes of this somewhat bloated post: program installation. This section has been written in chronological order, meaning that I started with the first program and proceeded onward to the last program. Some of the programs require that you have installed other programs, and unfortunately, unless explicitly mentioned, I don’t know which programs have those requirements.
Therefore, I recommend you follow the same installation order for your own computer. This will certainly make things simpler for newbies like myself, especially since I included the commonly used programs (e.g. BWA) before the less commonly used programs (e.g. Cairo).
As mentioned above, if you’re skipping around, I have written next to each application if it requires one of the preceding applications. However, I can’t be sure that this information is correct, so if you encounter a problem during installation, please let us know and we can amend our instructions.
Final note: The version numbers of programs might be out-of-date, so please change the instructions based on those new version numbers. We will try to update this document periodically to avoid this problem, but you should be forewarned!
Setting Your Path Directory
To run many of the applications, you will need to either place the applications in the PATH, define additional PATH locations, or note the location of the application each time you call it. To find the current PATH directories used by Unix, type "$PATH". You should see something similar to the following:
These folders are directly below the root directory and represent the places Unix looks when running an application. If you want to run any of these applications, you must download and compile the application. Before you begin installing any application, do the following (thanks to Nils Homer for the suggestion):Code:-bash: /sw/bin:/sw/sbin:/usr/bin:/bin:/usr/sbin:/sbin:/usr/local/bin:/usr/X11/bin:/usr/X11R6/bin
Create a directory in your home directory for the applications:
Edit your .profile file so this directory is in your PATH directories (you should see a file called “.profile”.):Code:mkdir -p $HOME/local/bin
Open with nano by typing:Code:ls –a
Add the following lines to your .profile file but DO NOT remove things in the current version: (you don’t need “sudo”):Code:nano .profile
Save your changes by typing "control O".Code:export PATH=$HOME/local/bin:$PATH
Exit nano by typing "control X".
Additionally, when you install applications, place the executable files in this directory so they are in a $PATH directory. You can either copy the application to the directory $HOME/local/bin or install using install script "./configure --prefix=$HOME/local”
BWA (http://sourceforge.net/projects/bio-bwa/files/; change naming in instructions based on BWA version)
NOTE: Reference indexes created in previous versions do not work in version 6 so you need to reindex each reference if you have worked with previous versions or more importantly if you are setting up and someone is providing you pre-index reference files- Click on the link above and download the newest version (called "bwa-0.6.1.tar.bz2").
- Move the "bwa-0.6.1.tar.bz2" file to your "ngs/applications" folder.
- Decompress the file by double clicking on it.
- Open Terminal (if previously open, ensure you are in your home directory).
- Navigate to the decompressed folder by typing:
Compile the application by typing:Code:cd ngs/applications/bwa-0.6.1
Lines of code will start appearing under your command. Make sure that no errors are listed!Code:make
You can confirm that the installation was successful by typing:
This should bring up a window with the BWA command options. (The first line is “Program: bwa (alignment via Burrows-Wheeler transformation)”.)Code:./bwa
Copy "bwa" to your path directory by typing:
Now Typing "bwa" into terminal at any point in any folder will launch the bwa programCode:cp bwa $HOME/local/bin
SAMtools (http://sourceforge.net/projects/samtools/; change naming in instructions based on SAMtools version)
- Click on the link above and download the newest version (called " samtools-0.1.18.tar.bz2").
- Move the "samtools-0.1.18.tar.bz2" file to your "ngs/applications" folder.
- Decompress the file by double clicking on it.
- Open Terminal (if previously open, ensure you are in your home directory).
- Navigate to the decompressed folder by typing:
Compile the application by typing:Code:cd ngs/applications/samtools-0.1.18
Lines of code will start appearing under your command. Make sure that no errors are listed!Code:make
You can confirm that the installation was successful by typing:
This should bring up a window with the SAMtools command options. (The first line is “Program: samtools (Tools for alignments in the SAM format)”.)Code:./samtools
Copy "samtools" and other valuable applicationsto your path directory by typing:
(We are assuming you followed our path directory here. If not, then change “$HOME/local/bin” to your location of choice.)Code:cp samtools $HOME/local/bin cp bcftools $HOME/local/bin cp vcfutils.pl $HOME/local/bin
Note: To save space, we have reduced the number of specific instructions, so instead of writing the exact lines of code required for commands, we will simply summarize them. This applies to decompressing the file, navigating to the decompressed folder, compiling the application, and copying to your path directory.
GATK (ftp://ftp.broadinstitute.org/pub/gsa...latest.tar.bz2)
According to the website (http://www.broadinstitute.org/gsa/wi...ading_the_GATK, “Outside the Broad Institute”), before you install GATK, you need to install three applications: JVM (Java Virtual Machine), Apache Ant, and Git. GATK requires that your version of JVM is 1.6 or greater, and your version of Apache Ant is 1.7.1 or greater.
JVM (Java Virtual Machine)
You should have JVM already installed on your computer. To confirm this, open Terminal and type:
Three lines of code should appear, starting with java version “1.6.0_29”. To update Java, search “Java” on the Apple website and find the most recent version that corresponds to your operating system.Code:java –version
Ant (http://ant.apache.org/)
You should already have Apache Ant installed on your computer. To confirm this, open Terminal and type:
You should see something like this: “Apache Ant(TM) version 1.8.2 compiled on October 14 2011”. If that doesn’t work, here’s how to install Ant manually:Code:ant –version
Click on the link above and download the latest version. (This version will probably be “apache-ant-1.8.2-bin.tar.bz2”.)
Move the “apache-ant-1.8.2-bin.tar.bz2” file to your “ngs/applications” folder.
Decompress the file.
Follow the somewhat complex instructions in the manual. To access the manual, click on the decompressed folder and look under docs/manual/install.html.
Git (http://git-scm.com/download)
Click on the link above and download the latest version. (This version will probably be “git-1.7.9.1-intel-universal-snow-leopard.dmg”.)
Install like any ordinary Mac application. (You thought it would be more complicated, right? You’re welcome!)
Now, onto installing GATK:
Click on the link above.
Move the “GenomeAnalysisTK-latest.tar.bz2” file to your "ngs/applications" folder.
Decompress the file and navigate to it.
To confirm this, Type in “java –jar GenoneAnalysisTK.jar --help”. (Do not copy this text! You will need to handtype it.)
You should see a message like: The Genome Analysis Toolkit (GATK) v1.4-30-gf2ef8d1, Compiled 2012/02/17 20:18:04.
Bowtie (http://sourceforge.net/projects/bowtie-bio/files/bowtie)
Click on the link above and download the latest version. (This version will probably be “bowtie-0.12.7-src.zip”.)
Move the “bowtie-0.12.7-src.zip” file to your “ngs/applications” folder.
Decompress the file and navigate to it.
Compile the application (“make”).
Copy "bowtie", "bowtie-build", and "bowtie-inspect" to your path directory.
To test the installation, navigate to the bowtie folder and type:
You should see a bunch of information stream onto the screen, and at the bottom, you should see:Code:bowtie indexes/e_coli reads/e_coli_1000.fq
Boost (http://www.boost.org/)[Prerequisites: SAMtools, $PATH configuration.]Code:# reads processed: 1000 # reads with at least one reported alignment: 699 (69.90%) # reads that failed to align: 301 (30.10%) Reported 699 alignments to 1 output stream(s)
WARNIHG: Do not download the newest version of Boost (i.e., version 1.48.0)! This version will not natively work with this protocol. Instead, install any earlier version of Boost—we recommend version 1.47.0—and follow the instructions below. (For more information, and instructions on how to modify the latest version of Boost, please visit: http://seqanswers.com/forums/showthread.php?t=16637.)
Click on the link above and download the latest version. (MAKE SURE THIS IS VERSION “boost_1_47_0.tar.bz2” OR EARLIER.)
Move the “boost_1_47_0.tar.bz2” file to your “ngs/applications” folder.
Decompress the file and navigate to it.
Build/bootstrap the package by typing:
Type in the following command:Code:./bootstrap.sh
This command will take awhile, so take your coworkers out for cappuccinos or something while you wait. Once it’s finished, the command will create “include” and “lib” subfolders in $HOME/local. You might get some error messages for which targets failed or were skipped, but ignore that because it won’t affect your other applications.Code:./bjam --prefix=$HOME/local --toolset=darwin architecture=x86 address-model=32_64 link=static runtime-link=static --layout=versioned stage install
In the new "include" folder, create a subfolder "bam".
Using Terminal, navigate to the SAMtools folder within ngs/applications.
Copy the "libbam.a" file in the SAMtools folder to $HOME/local/lib by typing:
Copy the header files (files ending in .h) in the SAMtools folder to $HOME/local/include/bam by typing:Code:cp libbam.a $HOME/local/lib
Tophat (http://tophat.cbcb.umd.edu/) [Prerequisites: Bowtie, SAMtools.]Code:cp *.h $HOME/local/include/bam
Click on the link above and download the latest version. (This version will probably be “tophat-1.4.1.tar.gz”. Click on the option that says “Source Code.”)
Move the “tophat-1.4.1.tar.gz” file to your “ngs/applications” folder.
Decompress the file and navigate to it.
Build the package by typing
[/li]Code:./configure --prefix=$HOME/local --with-bam=$HOME/local
Compile the application (by typing “make”).
Make the executable available in your $PATH directory by typing:
To test the Tophat installation, please visit the download website (http://tophat.cbcb.umd.edu/tutorial.html; search under “Testing the installation”) and follow these instructions:Code:make install
Click on the link above and download the file. (This file will probably be “test_data.tar.gz”.
Decompress the folder and navigate to it.
To process the data, type:
You should see lines of code after your command, beginning with something like the following:Code:tophat -r 20 test_ref reads_1.fq reads_2.fq
Cufflinks (http://cufflinks.cbcb.umd.edu/tutorial.html) [Prerequisites: Boost (SAMtools).]Code:[Mon May 4 11:07:23 2009] Beginning TopHat run (v1.1.1) -----------------------------------------------
Click on the link above and download the latest version. (This version will probably be “cufflinks-1.3.0.tar.gz”. Click on the option that says “Source Code.”)
Move the “cufflinks-1.3.0.tar.gz” file to your “ngs/applications” folder.
Decompress the file and navigate to it.
Build the package (with Boost, so different from Tophat instructions!) by typing
[/li]Code:./configure --prefix=$HOME/local --with-boost=$HOME/local --with-bam=$HOME/local
Compile the application (by typing “make”).
Make the executable available in your $PATH directory by typing:
To test the installation, you will need to download the cufflinks test data (http://cufflinks.cbcb.umd.edu/tutorial.html#ref; look under “Testing the installation). You can download the test text file anywhere (e.g. within your username folder) and navigate to that folder.Code:make install
Process the test data by typing:
You should see the following at the beginning of your output:Code:cufflinks test_data.sam
VarScan (http://varscan.sourceforge.net/) (Prerequisites: Samtools?)Code:You are using Cufflinks v1.3.0, which is the most recent release. [bam_header_read] EOF marker is absent. The input is probably truncated.
[ol]
[li]Click on the link above and download the latest version. (This version will probably be “VarScan.v2.2.8.jar”.)[/li]
[li]Move the “VarScan.v2.2.8.jar” file to your “ngs/applications” folder.[/li]
[li]Navigate to your “applications” folder.[/li]
[/ol]
To test the installation, type:
You should see the following at the beginning of your output:Code:java -jar VarScan.v2.2.8.jar
Picard (http://picard.sourceforge.net/)Code:VarScan v2.2 USAGE: java net.sf.varscan.VarScan [COMMAND] [OPTIONS]
[ol]
[li]Click on the link above and download the latest version. (This version will probably be “picard-tools-1.62.zip”.)[/li]
[li]Move the “picard-tools-1.62.zip” file to your “ngs/applications” folder.[/li]
[li]Decompress the file.[/li]
[li]Copy all .jar applications to your $PATH directory by typing:
While this step isn’t required, it makes things easier and the pipelines we provide use this concept.[/li]Code:cp .jar $HOME/local/bin
[/ol]
snpEff (http://snpeff.sourceforge.net/download.html)
To install snpEff, you must install both the program and the corresponding reference genome. These instructions include installing the most recent human genome from Ensembl (which is provided on their website). If you use a different genome, make sure that your genome version matches your snpEff version. (In other words, in this example, the genome version is for “v2_0_5” and the snpEff version is for “v2_0_5d”.)
[ol]
[li]Click on the link above and download the latest version of snpEff. (This version will probably be “snpEff_v2_0_5d_core.zip”.)[/li]
[li]Move the “snpEff_v2_0_5d_core.zip” file to your “ngs/applications” folder.[/li]
[li]Decompress the file.[/li]
[li]In the link above, download the latest version of the reference genome (This version will probably be “snpEff_v2_0_5_GRCh37.65.zip”.)[/li]
[li]Move the “snpEff_v2_0_5_GRCh37.65.zip” file to your “ngs/applications” folder.[/li]
[li]Decompress the file.[/li]
[/ol]
At this point, you’re probably feeling comfortable with these instructions, maybe even patting yourself on the back for understanding them. Well, prepare for more confusion, because we’re entering the wonderful seafaring world of ports!
For the following applications, you will need to install additional ports on your computer. There are two websites you can use to install them: MacPorts (http://www.macports.org/) and fink (http://www.finkproject.org/). The difference between them is that, in general, fink is more conservative about upgrading packages than MacPorts, so while the MacPorts version will be newer, the fink version might be more stable. We selected MacPorts for installing our packages, so our instructions will be tailored toward that program.
MacPorts (http://www.macports.org/install.php) [Prerequisites: XCode.]
To install MacPorts, please visit that website. Choose your operating system under the “Mac OS X Package (.pkg) Installer” section. Install like any ordinary software application.
To test the installation, close Terminal, meaning completely quit the application, and restart to run MacPorts. To begin the program, type in “sudo port”. You should see:
To install any port, type:Code:MacPorts 2.0.3 Entering interactive mode... ("help" for help, "quit" to quit)
where “program” is name of port you’re installing. This is the method for installing any of the ports used by the subsequent applications. As the program indicates, to exit MacPorts, type “quit” and press enter.Code:install program
FastX (http://hannonlab.cshl.edu/fastx_toolkit/download.html)
MacPorts: Install “pkgconfig”. (The program is called “pkgconfig 0.26”, found on page 171 of the MacPorts website.)
[ol]
[li]Click on the link above and download libgtextutils. (This version will probably be “libgtextutils-0.6.tar.bz2”.)[/li]
[li]Move the “libgtextutils-0.6.tar.bz2” file to your “ngs/applications” folder.[/li]
[li]Decompress the file and navigate to it.[/li]
[li]To install the program, like installing previous programs, type in “./configure” and press enter.
[li]To compile the application completely, type in “make” and press enter, then type in “sudo make install” and press enter.
[li]Make sure the program can identify gtextutils” by typing:
[/li]Code:export PKG_CONFIG_PATH=/usr/local/lib/pkgconfig:$PKG_CONFIG_PATH
[li]Once that command is processed, type:
You should see the following response:Code:pkg-config --cflags gtextutils-0.1
(If you have any questions about this step, or have any troubleshooting concerns about installing this application, please visit: http://hannonlab.cshl.edu/fastx_tool...nfig_email.txt.)[/li]Code:-I/usr/local/include/gtextutils-0.1/
[li]Click on the link above and download the latest version of FastX. (This version will probably be “fastx_toolkit-0.0.13.tar.bz2”.)[/li]
[li]Move the “fastx_toolkit-0.0.13.tar.bz2” file to your “ngs/applications” folder.[/li]
[li]Decompress the file and navigate to it.[/li]
[li]To install the program, like installing previous programs, type in “./configure”, then “make”, then “make install”.[/li]
[/ol]
Circos (http://mkweb.bcgsc.ca/circos/software/download/)
Before installing Circos, you will need to update your perl distribution to install all of Circos’s required packages. To install the packages, type the following in Terminal:
When it asks if you would like the program to configure things automatically, and choose the best CPAN mirror sites, type “yes”.Code:sudo perl -MCPAN -e shell
To install any package, type:
where “program” is name of package you’re installing. Before installing these packages, however, you will need to install GD. (I know, it’s like Inception, with a program installation within a program installation within a program….)Code:install program
GD (http://code.google.com/p/google-desk...tar.gz&can=2&q)
[ol]
[li]Click on the link above and download the latest version. (This version will probably be “gd-2.0.35.tar.gz”.)[/li]
[li]Move the “gd-2.0.35.tar.gz” file to your “ngs/applications” folder.[/li]
[li]Decompress the file and navigate to it.[/li]
[li]To install the program, like installing previous programs, type in “./configure”, then “make”, then “sudo make install”.[/li]
[/ol]
Here is a list of the packages you will need to install (please install them in the following order because some of the packages require other packages):
YAML
Config::General (v2.50 or later)
GD::Polyline (requires YAML)
List::MoreUtils
Math::Bezier
Math::Round
Math::VecStat
Params::Validate
Readonly
Regexp::Common
Set::IntSpan (v1.16 or later)
Clone
Text::Format
Also, if you get the message that says something like this:
then type “install CPAN”, then “reload CPAN”, to update to the latest CPAN version. (This process takes a couple minutes.)Code:New CPAN.pm version (v1.9800) available. [Currently running version is v1.9456]
All right, here are the instructions for installing Circos:
[ol]
[li]Click on the link above and download the bug fixes version. (This version will be something like“circos-0.56-1.tgz”.)[/li]
[li]Move the “circos-0.56-1.tgz” file to your “ngs/applications” folder.[/li]
[li]Decompress the file.[/li]
[li]Click on the link above and download the latest version. (This version will probably be “circos-0.56.tgz”.)[/li]
[li]Move the “circos-0.56.tgz” file to your “ngs/applications” folder.[/li]
[li]Decompress the file.[/li]
[li]Drag the decompressed file within the bug fixes version into the file of the latest Circos version. When prompted, choose “replace file”.[/li]
[/ol]
To test the Circos installation, please visit this website (http://circos.ca/software/download/tutorials/) and follow these instructions:
[ol]
[li]Click on the link above and download the tutorial file (This version will be something like“circos-tutorials-0.56.tgz”.)[/li]
[li]Move the “circos-tutorials-0.56.tgz” file to your “ngs/applications” folder.[/li]
[li]Decompress the file.[/li]
[li]Drag the decompressed tutorial file into the file of the latest Circos version. When prompted, choose “replace file”.[/li]
[li]Navigate to the “circos-0.56” folder.[/li]
[li]Access the tutorial by typing:
[/li]Code:cd tutorials/2/2
[li]Test the tutorial by typing:
[/li]Code:../../../bin/circos -conf ./circos.conf
[/ol]
You should see a series of commands flash onto the screen, eventually ending with:
If you navigate to that folder manually (“circos-0.56/tutorials/2/2”) and click on the “circos.png” file, you should see a circular graph of each human chromosome in different colors.Code:debuggroup summary,output 4.85s created PNG image ./circos.png (839 kb) debuggroup summary,output 4.86s created SVG image ./circos.svg (356 kb)
Finally, we copied the binary and library files to your path directory so you can just type "circos" instead of "bin/circos" each time you run the program. If you follow our folder hierarchy, then type the following commands in sequential order:
Also, within the circos folder, to create a couple directories for your personal use, type the following commands in sequential order:Code:cd ngs/applications/circos-0.56/bin cp circos $HOME/local/bin cd ../lib cp circos.pm $HOME/local/lib
Once you’ve created those directories, you need to populate your reference files. (For more information, please visit: http://circos.ca/tutorials/.) When you visit that website, you can download the hg19 karyotype, decompress the corresponding file, and drag it into your newly created “my_reference_files” folder.Code:cd ngs/applications/circos-0.52 mkdir my_plots mkdir my_reference_files mkdir my_config_files mkdir my_data_files
BEDTools (http://code.google.com/p/bedtools/)
[ol]
[li]Click on the link above and download the latest version. (This version will probably be “BEDTools.v2.15.0.tar.gz”.)[/li]
[li]Move the “BEDTools.v2.15.0.tar.gz” file to your “ngs/applications” folder.[/li]
[li]Decompress the file and navigate to it. (NOTE: The file will be renamed to something like “BEDTools-Version-2.15.0”.)[/li]
[li]To install the program, type in “make clean, then “make all”. You should see a series of commands being processed.[/li]
[li]To list the available binaries and confirm that they installed, type “ls bin”. You should see columns of files beginning with “annotateBed” in the upper lefthand corner and ending with “windowMaker” in the lower righthand corner.[/li]
[li]Copy the binaries to your PATH directory by typing:
[/li]Code:cp bin/* $HOME/local/bin
[/ol]
Pairoscope (http://pairoscope.sourceforge.net/) [Prerequisite: SAMTools]
Truthfully, installing this program is difficult, so brace yourselves, folks. Or as Samuel Jackson says in Jurassic Park, “hold onto your butts.”
Before installing pairoscope, you need to install Cairo. To install Cairo, type:
You should get the following response:Code:sudo port install cairo
Also, before installing pairoscope, you need to install CMake (http://www.cmake.org/cmake/help/install.html). To install the program, click on the link above and download the latest version. (This version will probably be “cmake-2.8.7-Darwin64-universal.dmg”.) Simply install like you would a normal application. (Oh, and when the bouncing colorful triangle appears on your Dock, click to “install command line links”.)Code:---> Computing dependencies for cairo ---> Cleaning cairo
Finally, here are the instructions to install pairoscope:
[ol]
[li]Click on the link above and download the latest version. (This version will probably be “pairoscope-0.2.tgz”.)[/li]
[li]Move the “pairoscope-0.2.tgz” file to your “ngs/applications” folder.[/li]
[li]Decompress the file and navigate to the applications folder.
To install pairoscope, type:
The screen will transform and you will see a series of capitalized instructions on the left and corresponding answers written in white text on the right. To toggle advanced mode, type “t”.Code:ccmake pairoscope-0.2
Scroll all the way down with the arrow keys until you reach “Page 2 of 2”. (NOTE: The following series of instructions are based on our folder architecture, and assume that you followed our instructions for installing SAMTools. If your folder architecture is different, please point ccmake to your corresponding SAMTools directories.)
To edit the Samtools include and library locations, follow these instructions:
[ul]
[li]Under “Samtools_INCLUDE_DIR”, type “/-----/local/include/bam”.[/li]
[li]Under “Samtools_LIBRARY”, type “/-----/local/lib/libbam.a”.[/li]
[/ul]
where “-----“ is the exact folder hierarchy of your computer. (To access that exact hierarchy, type in “cd” in the command line and type in “pwd”. The resulting line of code should be pasted into the “-----“ section described above.)
To configure, type “c”. You should see a warning appear that starts with:
You can ignore this warning, so type “e”. To generate and exit, type “g”.Code:CMake Warning (dev) in CMakeLists.txt:
Now, pairoscope is ready. To make pairoscope, navigate to the “applications” folder and type:
You should see a series of commands ending with:Code:cmake pairoscope-0.2
where the “-----“ is the same prefix described above.Code:-- Build files have been written to: /-----/ngs/applications
A new folder called “CMakeFiles” has been created in the “applications” folder. To make, navigate to the “applications” folder and type “make”. You will see a bunch of purple and green commands beginning with:
Copy the newly-created pairoscope program to your $PATH by typing:Code:Scanning dependencies of target pairoscope
To test the installation, type “pairoscope”. You should see a series of commands beginning with the following:Code:cp pairoscope $HOME/local/bin
FastQC (http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/)Code:Usage: pairoscope [options] <align.bam> <chr> <start> <end> <align2.bam> <chr2> <start2> <end2>
[ol]
[li]Click on the link above and download the latest version. (This version will probably be “Source Code for FastQC v0.10.0 (zip file)”. Please download the Source Code version.)[/li]
[li]Move the “fastqc_v0.10.0_source.zip” file to your “ngs/applications” folder.[/li]
[li]Decompress the file and navigate to it. (NOTE: The file will be renamed “FastQC”.)[/li]
And that’s it! (Seriously! According to the installation files: “Once unzipped it's ready to go.”)
HTSeq (http://pypi.python.org/pypi/HTSeq)
[ol]
[li]Click on the link above and download the latest version. (This version will probably be “HTSeq-0.5.3p3.tar.gz”.)[/li]
[li]Move the “HTSeq-0.5.3p3.tar.gz” file to your “ngs/applications” folder.[/li]
[li]Decompress the file and navigate to it.[/li]
[li]Install the program by typing:
[/li]Code:sudo python setup.py install
[/ol]
You should see a series of commands being processed and ending with:
(For more information about program installation, please visit: http://www-huber.embl.de/users/ander.../overview.html.)Code:Finished processing dependencies for HTSeq==0.5.3p3
chimerascan (http://code.google.com/p/chimerascan/)
[ol]
[li]Click on the link above and download the latest version. (This version will probably be “chimerascan-0.4.5a.tar.gz”.)[/li]
[li]Move the “chimerascan-0.4.5a.tar.gz” file to your “ngs/applications” folder.[/li]
[li]Decompress the file and navigate to it.[/li]
[li]Build the program by typing:
[/li]Code:python setup.py build
[li]Install the program by typing:
[/li]Code:sudo python setup.py install
To test the installation, you need to access python. To do that, leave the directory (you can type “cd ../” to move into the “applications” folder) and type:
You should see something like:Code:python
To test that the chimerascan libraries are in your PYTHONPATH, type “import chimerascan”, then “chimerascan.__version__”. (Just in case that last command is obscured, you should type in “chimerascan” followed by a period, followed by two underscores, then “version”, then two underscores.) You should see the following:Code:Python 2.6.1 Type "help", "copyright", "credits" or "license" for more information.
Success! To exit python, type:Code:'0.4.5'
Congratulations! You now have a working computer that can handle just about any sequencing data you throw into it!Code:exit()
If you have any problems during the installation process, I recommend that you search online for the error message you received. That’s how I managed to resolve many of the difficulties I encountered during this whole process.
Additionally, you should read the README files (you can by typing “less README” when you are in the program’s directory) when you have problems, because they might give you helpful information about what’s going wrong with that program.
Finally, please remember that this document is a work in progress. Right now, we have created a system that can manage the installation of the current application versions, but these versions often change, and with those changes come new program requirements or permissions. If you encounter any problems with future versions, please respond to this thread (preferably with a solution!) and we will make the corresponding updates.
(This document was made with help from Venkata Yellapantula.)
Last updated: March 7, 2012Last edited by Jon_Keats; 09-02-2012, 12:01 PM.Leave a comment:
-
From a BAM file you created using the same reference genome the following command should do it
Code:samtools view -H YourFile.bam | cut -f2- | sed 's/SN://g' | sed 's/LN://g' | awk 'NR > 1 {OFS="\t" ; print $1, "1", $2}' > YourChromosomeList.bedLeave a comment:
-
Hey Jon,
We are in total agreement in the definition of those terms, except for what you get out of picard insert metrics. I agree that tophat wants inner distance as the distance between the reads, and I believe that is what you get from picard as well. I ran a pipeline over the weekend with the Illumina's Body Map skeletal muscle paired end sample. Picard inner distance was 178bp. When Cufflinks was run on the same sample, it calculates the fragment length distribution automatically ( for the -m/--frag-len-mean value) and it was 176. I am inclined to believe -r/--mate-inner-dist for tophat and -m/--frag-len-mean for cufflinks refer to the same distance and therefore INNER_DISTANCE you get from Picard insert metrics should be left alone without subtracting the read lengths. What do you think? I'm not trying to prove you wrong but merely trying to clear out any confusions either of us might have.Leave a comment:
-
Why is this post not stickied in bioinformatics forum? This is a really great info on how-to for noobs like me. Would have saved couple days of googling stuff, trial and errorLeave a comment:
-
Hi Ahmetz,
Tophat -r is looking for the "mate-inner-distance" which is the distance between the ends of read 1 and read 2 not the distance between adaptor1 and adaptor2. We have talked about having a wiki locally for terminology but this is what we often use.
[Adaptor1]>>>>read1>>>---------<<<read2<<<<[Adaptor2]
Fragment Size = distance from beginning of adaptor 1 to the end of adaptor 2
Insert Size = size of DNA between adaptor 1 and adaptor 2
Inner Distance (what tophat wants) = the distance between the end of read1 and the end or read2. In the example above if you consider each - as a nucleotide and the ends of each read defined by > and < then the inner-distance is 9.
Golharam,
We are currently updating the RNAseq pipeline to work with Topat 1.4 to take advantage of the new align to transcriptome step that I've always pushed to have in an RNAseq aligner. It will also look a bit more similar to our exome pipeline so that it can add read groups.
Ultimately, I'd envision there being a exome pipeline, RNAseq pipeline, mate-pair pipeline, and then a summary pipeline that will merge all three results and create the circos plot. Should be fairly easy to pipe the results of the current pipeline into circos but I always plot more than a single data type so I didn't bother to included it. But not a bad idea to included as a launch query so a user could pipe the results directly.Leave a comment:
-
Hey Jon,
While going over your pipeline, I noticed something. With this line:
INNER_DISTANCE=`head -n 8 ${SAMPLE_NAME}_Picard_InsertMetrics.txt | tail -n 1 | cut -f5 | awk -v var1="$COMBINED_READ_LENGTH" '{printf "%.0f\n", $1-var1}'`
you're calculating the insert size as you use the INNER_DISTANCE value with -r option in Tophat. However, the Picard output, the 5th column is already MEAN_INSERT_SIZE, why are you subtracting COMBINED_READ_LENGTH from the mean insert size again?Leave a comment:
-
Hi Jon - The BWA Exome Pipeline looks great. I assume the RNA-Seq pipeline is different just by looking at the pdf you posted. I assume the last RNA-Seq pipeline was from 09-26-2011. I also see that the Circos stuff wasn't included. Is there a reason why?Leave a comment:
-
I'm a bit amazed by how many people follow or have read this thread, especially with it recently passing ECO introduction sticky thread. I wonder if I can reference this thread to the grant reviewers that say I need more informatics help on my grants... Oh well enough complaining.
I've been finalizing my exome pipeline for one of the projects that deals with human myeloma cell lines were there is not germline/constitutional DNA sample available. The primary goal is to identify variants in genes identified in our patient sample screens to identify potential model systems and appropriate controls.
I'll post the entire pipeline and examples of all the required input files but the pipeline looks like the following (see below) and generates a Summary Run Report shown (see below) after the following command is initiated in a directory full of fastq files (can be a total mixed bag and either uncompressed, gzip, or bzip2 compressed)
<BWA_exome_pipeline.sh> <run_parameters.ini> <sample_sheet.txt>
Code:*** Analysis Run Report *** Sample KMS11_JPN_p3_TruSeq70MbExome was Analyzed ----------------------------------------------------------------------------- *** Lane Alignment Run Report *** Sample KMS11_JPN_p3_TruSeq70MbExome_GCCAAT_L7 was Analyzed The two read files processed were KMS11_JPN_p3_TruSeq70MbExome_GCCAAT_L7_R1.fastq.gz and KMS11_JPN_p3_TruSeq70MbExome_GCCAAT_L7_R2.fastq.gz KMS11_JPN_p3_TruSeq70MbExome_GCCAAT_L7_R1.fastq.gz contained 50457788 reads KMS11_JPN_p3_TruSeq70MbExome_GCCAAT_L7_R2.fastq.gz contained 50457788 reads ----------------------------------------------------------------------------- *** Lane Alignment Run Report *** Lane KMS11_JPN_p3_TruSeq70MbExome_GCCAAT_L8 was Analyzed The two read files processed were KMS11_JPN_p3_TruSeq70MbExome_GCCAAT_L8_R1.fastq.gz and KMS11_JPN_p3_TruSeq70MbExome_GCCAAT_L8_R2.fastq.gz KMS11_JPN_p3_TruSeq70MbExome_GCCAAT_L8_R1.fastq.gz contained 50279910 reads KMS11_JPN_p3_TruSeq70MbExome_GCCAAT_L8_R2.fastq.gz contained 50279910 reads ----------------------------------------------------------------------------- Sample Summary: After alignment with BWA the mean insert size was determined to be 270.820553bp with a standard deviation of 91.662134 The alignment metrics for this sample are as follows: Alignment Metrics: 83 - Average Read Length 201475396 - Total Number of Passing Filter Reads Aligned with bwa 199321958 - Number of Reads Aligned 99991035 - Number of Reads from Read1 Aligned 99330923 - Number of Reads from Read2 Aligned 0.989312 - Percentage of Unique Reads Aligned to at least one Position 0.992588 - Percentage of Unique Read1 Reads Aligned to at least one Position 0.986035 - Percentage of Unique Read2 Reads Aligned to at least one Position 0.844223 - Percentage of Aligned Bases, which are greater than Q20 0.99472 - Percentage of Reads Aligned as Pairs 0.000131 - Percentage of Reads which appear to be Adaptor Reads Duplication Metrics: 500572402 - Estimated fragments in Library 0.095995 - Percent Duplicate Reads Transcriptome Metrics: 0.56342 - Percent mRNA Bases 0.247456 - Percent Coding Bases 0.315964 - Percent UTR Bases 0.293039 - Percent Intronic Bases 0.143454 - Percent Intergenic Bases 0.661081 - Median 5 Prime Coverage Bias 0.730395 - Median 3 Prime Coverage Bias 0.938235 - Median 5/3 Coverage Ratio Capture Metrics: 182341432 - Number of unique alignment events [non-duplicates] 0.905031 - Percent unique alignment events [non-duplicates] 162369533 - Number of unique alignment events with MAPQ>0 0.89047 - Percent of reads which are unique alignments with MAPQ>0 13.446 - Gigabases of unique alignments with MAPQ>0 0.696883 - Percent of aligned bases within padded bait region 0.303117 - Percent of aligned bases not associated with a bait region 101.257402 - Mean coverage of the target region 0.376064 - Percentage of bases on target 5.057 - Gigabases of on target base pairs 23.291078 - Fold enrichment 0.003347 - Percent of undetected targets 0.95061 - Percent of targets with greater than 10x coverage 0.923333 - Percent of targets with greater than 20x coverage 0.886545 - Percent of targets with greater than 30x coverage 0.03663 - Percent of low GC targets which are under represented 5.835684 - Percent of high GC targets which are under represented Quality Metrics: This run consists of paired 83x83bp reads 32.6069 - Mean phred score for read1 32.216839 - Mean phred score for the first cycle of read1 30.498119 - Mean phred score for the last cycle of read1 31.2961 - Mean phred score for read2 30.722569 - Mean phred score for the first cycle of read2 28.530552 - Mean phred score for the last cycle of read2 Variant Calling Metrics: 40956 - Number of high-confidence variants called by both GATK and Samtools 2.63 - Ti/Tv Ratio for high-confidence variants called by both GATK and Samtools 2059 - Number of high-confidence variants that do not exist in dbsnp 2.19 - Ti/Tv Ratio for high-confidence variants called by both GATK and Samtools that do not exist in dbsnp 3266 - Number of high-confidence variants that do not exist in 1000G project 2.00 - Ti/Tv Ratio for high-confidence variants called by both GATK and Samtools that do not exist in 1000G project 94.97 - Percentage of high-confidence variants that exist in dbsnp 92.60 - Percentage of variants called by GATK and filtered by Samtools that exist in dbsnp 81.86 - Percentage of variants called by Samtools and filtered by GATK that exist in dbsnp 87.19 - Percentage of variants called exclusively by GATK that exist in dbsnp 41.50 - Percentage of variants called exclusively by Samtools that exist in dbsnp 92.95 - Percentage of variants called by but filtered by GATK and Samtools that exist in dbsnp 581 of the 3266 high-confidence variants absent from 1000G are non-synonymous changes The 581 non-synonymous changes includes the following genes, which are mutated in the MMGI Study: ZNF804A -697T 2 185802211 C CACA [0, 0, 78, 75] rs5836928 The 581 non-synonymous changes includes the following positions, which exist in the Cosmic database: ZNF804A -697T 2 185802211 C CACA [0, 0, 78, 75] rs5836928 FGFR3 Y373C 4 1806099 A G [8, 4, 14, 5] rs121913485 The 581 non-synonymous changes includes the following nonsense changes: RP4-788L13.1 E298* 1 99771640 G T [28, 35, 7, 11] . TAF1A Y36* 1 222761798 G T [53, 28, 12, 11] . MAP4K4 Q488* 2 102482984 C T [8, 19, 7, 14] . PTPRN Q22* 2 220172517 G A [39, 75, 19, 15] . PAQR3 S133* 4 79851430 G C [29, 26, 25, 27] . CYFIP2 W204* 5 156786100 G A [7, 13, 9, 11] . ANKS1A E420* 6 34957049 G T [26, 23, 12, 9] . PLEKHA2 C182* 8 38810216 T A [52, 33, 33, 15] . SOX6 R596* 11 16010642 G A [32, 26, 15, 11] . CD4 W53* 12 6909582 G A [12, 35, 7, 16] . GCOM1 Y122* 15 57913853 T G [39, 26, 17, 16] . MEF2A K25* 15 100185784 A T [41, 5, 18, 1] . NOXO1 W269* 16 2029435 C T [19, 27, 24, 33] . SRCAP Q2* 16 30712149 C T [17, 29, 8, 9] . ZNF613 E134* 19 52447644 G T [81, 31, 18, 9] . ZIM2 R335* 19 57286637 G A [37, 32, 34, 16] . FTHL17 E148* X 31089629 C A [0, 0, 30, 8] rs7057057 MAGEB16 R272* X 35821127 C T [0, 0, 60, 63] rs4829392 MAGEE2 E120* X 75004529 C A [0, 0, 27, 28] rs1343879 UBE2NL L89* X 142967468 T G [0, 0, 49, 62] rs237520 The 581 non-synonymous changes includes the following frameshift changes: PROX1 NA 1 214170645 AG A [18, 17, 62, 63] . DNAH14 NA 1 225328438 G GAT [10, 0, 29, 1] . FGFR3 NA 4 1809127 CGT C [0, 0, 27, 26] rs34003391 NR3C2 NA 4 149002016 AT A [0, 0, 11, 12] rs10708334 ZNF608 NA 5 123982405 CT C [26, 3, 10, 3] . CYFIP2 NA 5 156721863 T TC [0, 0, 16, 19] rs76159126 STEAP2 NA 7 89854652 ACAAAT A [20, 27, 33, 45] . OR13C2 NA 9 107367392 TGTTA T [23, 19, 25, 39] rs71991336 C9orf173 NA 9 140147822 GATGCACCCTTCTGGCTGGCCAACCCTTCT G [11, 15, 11, 18] . CREB3L1 NA 11 46342259 A AG [0, 0, 54, 2] rs71038900 DIXDC1 NA 11 111853106 G GC [0, 0, 33, 51] rs67635503 TREH NA 11 118529044 C CG [0, 0, 17, 24] rs11448549 HSP90B1 NA 12 104326109 TAGAG T [12, 19, 20, 16] . PKD1L2 NA 16 81242148 GTT G [0, 0, 61, 26] rs62734462 LRRC59 NA 17 48474672 TGGTCA T [9, 14, 2, 7] . HSH2D NA 19 16268207 TA T [0, 0, 7, 18] rs5827321 LTBP4 NA 19 41123093 A AG [0, 0, 18, 43] rs67216392 RASIP1 NA 19 49230400 GA G [22, 49, 5, 18] . CD33 NA 19 51729577 ACCCAACAACTGGTATCTTT A [37, 19, 24, 14] . ADAMTS1 NA 21 28210040 GA G [69, 35, 19, 8] . C21orf49 NA 21 34169317 C CT [0, 0, 48, 55] rs5843567 COL6A2 NA 21 47545369 A AC [0, 1, 29, 69] . CLTCL1 NA 22 19189003 A AC [0, 0, 1, 22] rs78649162 EFHC2 NA X 44202890 G GC [0, 0, 2, 35] rs5902346 SSX9 NA X 48163733 TC T [0, 0, 57, 22] rs112256157 NUDT11 NA X 51239295 ATCCTCGAGGCAGCC A [0, 0, 4, 12] rs78182391 TCEAL6 NA X 101395780 T TG [0, 0, 27, 90] rs11408120 TEX13A NA X 104464276 CA C [0, 0, 36, 7] rs66463437 The 581 non-synonymous changes includes the following start codon losses: TLR8 M1V X 12924826 A G [0, 0, 17, 48] rs3764880 The 581 non-synonymous changes includes the following stop codon losses: MPL *636W 1 43818443 A G [31, 17, 45, 40] . PCSK2 *604Q 20 17462713 T C [26, 13, 18, 14] .
Leave a comment:
-
Hi Anjulka,
I completely understand. The source was not obvious, I was following the GATK best practice guide which no longer suggests the picard fix-mate step. Similar to your concern I spent some time searching for the reason and finally found this thread on the GATK Get Satisfaction help page (http://getsatisfaction.com/gsa/topic...el_realignment). See the first reply by Eric Banks (GATK developer)Leave a comment:
-
Tumors contain complex mixtures of cell populations that evolve in response to treatment and host-specific factors. Tissue biopsies provide only static snapshots of a tumor’s state. But what if we could follow that evolution over time using a minimally invasive technique?
Liquid biopsies can detect tumor-derived material circulating in the bloodstream, providing a way to study treatment response, detect emerging resistance, and discover new biomarkers. Circulating...Yesterday, 09:55 AM -
Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.
We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing...
Leave a comment: