Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • First HiSeq 3000 data

    Hello,

    in case you are interested, we have posted some results from our first HiSeq 3000 runs as well as some information and considerations on the changes introduced by the new HiSeq 3000 and Hiseq 4000 sequencer generation. The yields on the first two runs were higher than expected at about 340 million reads per lane. The quality looks good.
    There is also link to the complete data from a PhiX lane (including the clusters that did not "pass filter").

    http://dnatech.genomecenter.ucdavis....data-download/

    Btw, the cluster images do not give away the patterned character of the flowcells. Please see the attachment.

    Best,
    Lutz
    Attached Files
    Last edited by DNATECH; 05-07-2015, 12:48 AM.

  • #2
    Some Q30 plots.
    Attached Files

    Comment


    • #3
      Sweet my company just got one and we'll do our training run in a couple weeks from now. The instrument was setup and configured nearly a month ago so it's bothering to see it idle for so long.

      Comment


      • #4
        We are actually waiting for flow-cells for several weeks; I guess Illumina is surprised that anybody wants to use the new sequencers?

        Comment


        • #5
          @DNATECH: Based on this (and your other post) it sounds like you need "near perfect libraries" to get good data from patterned flowcells. This could be a problem for core facilities, where "variable" quality libraries come in from customers.

          It would be interesting to hear about your experiences as real world customer libraries start flowing through.

          Comment


          • #6
            Originally posted by DNATECH View Post
            Hello,

            in case you are interested, we have posted some results from our first HiSeq 3000 runs as well as some information and considerations on the changes introduced by the new HiSeq 3000 and Hiseq 4000 sequencer generation. The yields on the first two runs were higher than expected at about 340 million reads per lane.
            You mean 340 million pass-filter clusters per lane?

            --
            Phillip

            Comment


            • #7
              What final concentration was the phiX library that you clustered? I mean after neutralization?

              I mean is there no danger of overclustering anymore? That was what I was hoping for when I heard about the patterned flowcells...

              --
              Phillip

              Comment


              • #8
                Yes, an average of 340 million clusters passing filter per lane.

                Originally posted by pmiguel View Post
                You mean 340 million pass-filter clusters per lane?

                --
                Phillip

                Comment


                • #9
                  Hi Miguel,

                  the input was 5ul of PhiX at 2 nM. So far we have used 2 nM concentrations for all our libraries/lanes. Illumina recommends up to 3 nM.
                  From what our FAS told us, I got the impression under-loading could be more detrimental than over-loading.

                  Originally posted by pmiguel View Post
                  What final concentration was the phiX library that you clustered? I mean after neutralization?

                  I mean is there no danger of overclustering anymore? That was what I was hoping for when I heard about the patterned flowcells...

                  --
                  Phillip

                  Comment


                  • #10
                    Hi GenoMax,

                    perhaps we are just being careful at the moment - since Illumina seems to be very careful and there is very little information so far. The customer samples (n=11) have been looking great so far except one; this sample had some larger low complexity component to it (which we were not aware off). For this sample the Q30 rates dropped after the first 60 to 70 bases of low complexity bases from 95% to 70%.

                    Originally posted by GenoMax View Post
                    @DNATECH: Based on this (and your other post) it sounds like you need "near perfect libraries" to get good data from patterned flowcells. This could be a problem for core facilities, where "variable" quality libraries come in from customers.

                    It would be interesting to hear about your experiences as real world customer libraries start flowing through.

                    Comment


                    • #11
                      Originally posted by DNATECH View Post
                      Hi Miguel,

                      the input was 5ul of PhiX at 2 nM. So far we have used 2 nM concentrations for all our libraries/lanes. Illumina recommends up to 3 nM.
                      From what our FAS told us, I got the impression under-loading could be more detrimental than over-loading.
                      Wow, 2000 pM? I think the highest we ever went on the HiSeq2500 was 23 pM.

                      --
                      Phillip

                      Comment


                      • #12
                        To get 2-2.5x more clusters (compared to a 2500) load 100x more? DNA binding in nanowells must not be very efficient.
                        Last edited by GenoMax; 05-08-2015, 11:35 AM.

                        Comment


                        • #13
                          Hi Pmiguel,

                          the basic procedure looks like:
                          - 5 ul of library (2 nM to 3 nM including PhiX)
                          - add 5 ul 0,1 N NaOH
                          - add 5 ul Tris (200mM)
                          - add 35 ul Enzyme Master Mix
                          - load all 50 ul onto cBot

                          Originally posted by pmiguel View Post
                          Wow, 2000 pM? I think the highest we ever went on the HiSeq2500 was 23 pM.

                          --
                          Phillip

                          Comment


                          • #14
                            I finally finished downloading these, and I'll take a look at the quality from mapping. But before I do that, I always trim adapters... but I was never sure what kind of adapters PhiX reads had. They don't exactly match any adapters in my list, so I'll call them "PhiX adapters". Here they are, for reference:

                            >Read1_adapter
                            AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTGAAA
                            >Read2_adapter
                            AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA

                            Also, at least for the first 4 million reads, 29.36% failed the chastity filter.

                            Comment


                            • #15
                              Hi Brian,

                              Thanks for looking at the data. The files that I uploaded have 482,680,800 reads. The sequencer generates "reads" for each single nanowell - no matter if it is loaded or not. Thus, the figure of 30% or higher "failing" reads is expected. The SAV viewer indicates a total of 482.68 million nanowells. According to Illumina 60% to 70% of clusters passing filter are considered to be very good; because the figure is calculated with respect to the total number of nanowells. I did intentionally upload files including all non-passing reads (the majority of the "not passing filter" data are likely simply empty nano-wells though).

                              Lutz


                              Originally posted by Brian Bushnell View Post
                              I finally finished downloading these, and I'll take a look at the quality from mapping. But before I do that, I always trim adapters... but I was never sure what kind of adapters PhiX reads had. They don't exactly match any adapters in my list, so I'll call them "PhiX adapters". Here they are, for reference:

                              >Read1_adapter
                              AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTGAAA
                              >Read2_adapter
                              AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA

                              Also, at least for the first 4 million reads, 29.36% failed the chastity filter.
                              Last edited by DNATECH; 05-08-2015, 03:38 PM.

                              Comment

                              Latest Articles

                              Collapse

                              • seqadmin
                                Latest Developments in Precision Medicine
                                by seqadmin



                                Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

                                Somatic Genomics
                                “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
                                05-24-2024, 01:16 PM
                              • seqadmin
                                Recent Advances in Sequencing Analysis Tools
                                by seqadmin


                                The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
                                05-06-2024, 07:48 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by seqadmin, 05-24-2024, 07:15 AM
                              0 responses
                              15 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 05-23-2024, 10:28 AM
                              0 responses
                              18 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 05-23-2024, 07:35 AM
                              0 responses
                              22 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 05-22-2024, 02:06 PM
                              0 responses
                              10 views
                              0 likes
                              Last Post seqadmin  
                              Working...
                              X