Hi, all,
I just prepared couple of libraries with the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina. After run them on a Qiaxcel...
11 results in 0.0028 seconds.
-
primer-dimer or adaptor-dimer
-
Custom multiplex sequencing barcodes / indexes (8-mer)
Hi all,
I have synthesised a custom set of Illumina adaptors that use an 8-mer index to allow 384-plex multiplexing. I got these index... -
TruSeq RNA Sample prep kit v2 adapters concentration?
Hi!
Does anyone know what is the stock concentration of the TruSeq RNA sample prep v2 adapters ?
Many thanks! -
Do illumina fastq file have barcode and adaptor?
Hi all,
I saw this thread http://seqanswers.com/forums/showthread.php?t=8176. It said that in illumina fastq file, there is no barcode. But when... -
How to fill the gap after tagmentation? Can I use Klenow fragment?
I am trying to making Illumina sequencing library using transposon based method to add adaptor. However, instead of using the adaptor used in Nexera kits,... -
New to sequencing...
I have only just started my degree and am having some trouble with my work. I was hoping some of you lovely professionals out there could give me some... -
Remove adaptors
Hi, there!
I'm pretty new in this area. I have a question. I get the Illumina RNA seq data. Do I need to trim the adaptors manually? And... -
Sequencing low complexity libraries: effects on data
I am planning some experiments that involve sequencing products that have a standard adaptor sequence at the start.
Now I know that the... -
Problems with small RNA adaptor sequences
Hi all,
I've recently received some small RNA data and previously I used this sequence 'TCGTATGCCGTCTTCTGCTTG' to remove the 3' adaptors.... -
software to cut adaptor
Hi all,
Since I am new here, I am not familiar with the data analysis from SOLiD platform.
Yesterday, I was told to cut the... -
% unmapped reads
Hi all,
For any solexa run, we see 60-80% passing filter reads, of which 70-90% map to the reference sequence. There are quite a few reads...
