Dear All,
The repeat families predicted by RepeatModeler contain known TEs and unknown ones. How do we know whether some of which may be...
12 results in 0.0025 seconds.
-
RepeatModeler results contain functional domains?
-
Genome assembly and annotation tips sharing
De novo genome assembly has become an affordable and achievable method to solve biological problems. Following the recent Genome of Animal and Plants... -
Genome annotation with BRAKER: how to interpret the results?
Hello,
I am new to the genome annotation and I'm lost with the interpretation of results produced by BRAKER.
- I have a de novo
-
How to get starting and ending positions of 5'UTRs and 3'UTRs?
Hi everyone!
I have a gff file with genome annotations downloaded from NCBI (http://www.ncbi.nlm.nih.gov/genome/23338). Does anyone know... -
Evaluating RAST annotation
Hi everyone,
I'm doing an annotation using RAST in a non-ordered contigs genome and I'm having trouble to determine if the annotation was done... -
DFam database: what on earth is a "cut and paste" repeat?
Hi All,
Downloaded some repeat-masking data from DFam (http://www.dfam.org/) and along with LINE, SINE, LTR etc repeats it includes a... -
RAST server annotation result to STAMP statistical software
Hi,
I have annotated the 5 bacterial genome using RAST server, can we take the output from RAST server and use it in a STAMP statistical software.... -
Fungal Genome Annotation
I have a genome (fungal genome), it looks like-
>contig1
ATTAAATATACCCCACAAAATAGAGACAGAGACACATATTAA
>contig2
ATATCGAGAGAGGGCGCGCGCCGCGCGGCCGCGAGGAGAGTATA... -
What's next after Genome Assembly?
Hi,
This is a broader scope question rather than specific details.
Before I have experience with RNAseq alignment, and now... -
Annotation of multiple bacterial genomes
Hi,
I would like to annotate a subset of the Human Microbiome Project Reference Database http://www.hmpdacc.org/HMREFG/
and am wondering... -
Free Genomics Data Reference Library for the Community
In order to accelerate our understanding of the molecular basis of diseases such as cancer, it is imperative for the research community to be able to...Last edited by GenePool; 11-22-2014, 12:16 AM. -
zxyeo started a topic Why repeat masking is important prior to gene model construction during de novo genomin GeneralWhy repeat masking is important prior to gene model construction during de novo genom
Dear all,
I am new to the annotation of novel genome assembly.
So far, many workflows of genome annotation will first carried...
