TruSeq - ChIP-seq library construction

[ETHANol]

Phillip, that is interesting and thank you very much for sharing. Is the 25 bp peak a marker or is that an oligo as well.

I think what it must be is a long oligo that is the sequence of the Univeral TruSeq Adapter (5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T) and a short corresponding to the Index TruSeq adapter up to the bar code (5'-GATCGGAAGAGCACACGTCTGAACTCCAGTCA*C). I hate to say impossible but it's pretty close to impossible for the PCR to be specific if the second oligo is essentially the entire adapter sequence.

Note: Either of those oligos could be shorter on their 3' ends and still in theory work. I'm in no way saying those oligos are the same as what is in the Illumina PPC.

Now a question is why use such long oligos for the PCR?

And anyone care to mass spec the Illumina PCR Primer Cocktail to get us the actual length and sequence?

[pmiguel]

[...]
I think you are mistaken about the primer sequences. PE PCR Primer 1.0 and the PCR Primer, Index 1 are from the old kits. I pretty sure the TruSeq PCR primers are the different and Illumina is not releasing their sequence.
[...]

Here is some evidence that the TruSeq PCR primers are just the entire TruSeq adapter oligos:
We ran an Agilent RNA pico chip on 0.2 ul from the "PPC" (PCR primer cocktail) from:

A DNA TruSeq A kit:


An RNA TruSeq Bkit:


Here is the ladder electropherogram for that chip:


The sizes are a little longer than expected (58 and 63 nt for the A strand and B strand oligos, respectively). But I guess that is down to mediocre accuracy for the pico chip in that size range.
--
Phillip

[ETHANol]

After doing 4 cycles of PCR are you still doing a blind cut size selection or can you visualize a band on the gel?

I am still cutting blind but since the Y-shaped adapters are now double stranded DNA you know exactly where your DNA is.

After your final PCR, are you able to see anything on a gel?

I don't run it on a gel after the final PCR. I take 1 μl of the library and run that on the Bioanalyzer to make sure there are no adapter-dimers.

[advanT]

Hi Ethanol,

After doing 4 cycles of PCR are you still doing a blind cut size selection or can you visualize a band on the gel?

After your final PCR, are you able to see anything on a gel?

thanks!

[jlove]

KAPA makes a NGS amplification kit for Illumina....I use P5 and P7 for PCR primers @ 500 nM each final, and KAPA HiFi enzyme, and I use their (KAPA's) PCR cycling conditions. The conditions are printed in the pamphlet that goes with the enzyme (part # KK2611).

[ETHANol]

advanT, I convert the Y-shaped adaptors to double stranded DNA prior to size selection because it seems the Y-shapped adapter-dimer runs really slow in an agarose gel. Cutting above 250 bp was giving me a significant amount of adapter-dimer after the final PCR. It probably runs differently in different types and percentages of agarose. And then who knows where the bulk of your sample ligated to the adapters is running. To circumvent this, I figured why not just convert it to double stranded DNA. Two cycles of PCR should take care of this but I figured 4 would make some extra DNA and the gel purification seems to be a step prone to DNA loss and cross-contamination so why not add a couple extra cycles. I guess I could have done the full PCR at this step but then you have to worry about getting 'bubbles and daisy chains' from over-amplification and then missing a lot of sample during size selection. That and I've read people have better luck when size selecting before PCR.

jlove, I was looking all over for what would work in place of what Illumina calls the TruSeq PCR primer cocktail. Thanks. I'm using P5 and P7 with an extra G at the end (no reason) so I have a little more hope now. Maybe I should bump up the annealing temp during PCR. 60˚C seem on the low side for the primers I using.

[jlove]

Are you looking for TruSeq PCR primers? I use the P5 and P7 sequences (flowcell oligos)

[pmiguel]

[...]

I think you are mistaken about the primer sequences. PE PCR Primer 1.0 and the PCR Primer, Index 1 are from the old kits. I pretty sure the TruSeq PCR primers are the different and Illumina is not releasing their sequence.

I guess I should run an aliquot of the PCR Primer Cocktail (PPC) from the kit on a small RNA Bioanalyzer chip. That should give me the approximate size of the oligos.

I sent a sample out today for sequencing on the HiSeq, so we'll see if it works.

Good luck! Please let us know if it works for you.

--
Phillip

[advanT]

I noticed in the protocol that you have a 4 cycle PCR step just after ligation and then another 10-15 cycles post size selection. You mentioned that the 4 cycles after ligation is for generating double strands? I haven't seen this extra step being done before. Did you do this because you were worried you wouldn't see any material on the gel or ?

thanks!

[ETHANol]

I have the Illumina primer document, although I did not get it from our FAS (doesn't exist in Greece) and I certainly didn't get it from BioAnalytica, this is a company that is not accepting order for all of August (and didn't notify us) and represents the most difficult part of doing research in Greece.

I think you are mistaken about the primer sequences. PE PCR Primer 1.0 and the PCR Primer, Index 1 are from the old kits. I pretty sure the TruSeq PCR primers are the different and Illumina is not releasing their sequence.

I sent a sample out today for sequencing on the HiSeq, so we'll see if it works.

[pmiguel]

That's a great idea to run denatured libraries on an RNA chip.

Thanks. But did I mention the caveat? If the ssDNA reanneals at some point, the result will be confusing because, near as I can tell, dsDNA runs faster on Agilent chips than ssDNA. For details please see:

http://seqanswers.com/forums/showthread.php?t=12852

http://seqanswers.com/forums/showthread.php?t=12501

I remembered seeing the pooling instructions on some Illumina publication a while back but after searching I couldn't find it anywhere. But after some Googling I found it here from Agelient:

http://www.chem.agilent.com/Library/usermanuals/Public/G7530-90000_SureSelect_IlluminaXTMultiplexed_v.1.2.pdf

It seems like Illumina took it down for some reason.

Thanks. If nothing else it proves that the guys at Illumina don't have some massive blind spot about this issue.

What do you mean I can get the full set of sequences from my FAS. What/who is a FAS? I have a publication from Illlumina that has all their oligonucleotide sequences except the primers in the TruSeq PCR Primer Cocktail. Regardless whatever/whoever my FAS is here in Greece, I'm sure they are not giving me anything.

So maybe I am being naive about the situation outside the US, but an email to our "Field Application Specialist" -- scientists who work for Illumina and travel around doing onsite training if you have an Illumina instrument and otherwise serving as an additional point of contact with Illumina -- asking for the "Illumina Adapter Sequence Letter" PDF yields a PDF being emailed that contains the sequence of pretty much all Illumina oligonucleoties used for their sequencing technology. Phosphorothioate linkages are not denoted, however.

If you do not know who your FAS is, or suspect you do not have a regional FAS, perhaps call to your local distributor, BioAnalytica S.A., would get you that information? My apologies if I am completely mistaken. I am just guessing.

I'm not sure what you mean by the statement that Illumina is using the entire adapter as a PCR primer, including the barcode. That can not be possible since there is only one PCR Primer Cocktail (PPC) to be used with all the adapters, correct? I assume the PCR primers must be sort of short since the lowered the annealing temp in the PCR to 60˚C.

Okay, the Illumina Adapter Sequence Letter contains the following obnoxious text:

For individual sequences contained in this letter, lllumina grants you permission to distribute them outside your institution, or publish individual sequences in presentations, manuscripts, or publications authored by you, as long as it is accompanied by the following copyright notice:

Oligonucleotide sequences © 2007-2011 Illumina, Inc. All rights reserved.

If you modify or adapt any sequence information contained in this letter and distribute or publish the modified sequences, it must be accompanied by the following copyright notice:

Oligonucleotide sequences © 2007-2011 Illumina, Inc. All rights reserved.
Derivative works created by Illumina customers are authorized for use with Illumina instruments and products only. All other uses are strictly prohibited.

First, although I will comply with the above terms specified by Illumina, I want to make it clear that this in no way indicates that I agree with, or even believe to be valid, the copyrighting of oligonucleotide sequences.

Here is the PE PCR Primer 1.0:

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

and here is the "PCR Primer, Index 1":

CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTC

Oligonucleotide sequences © 2007-2011 Illumina, Inc. All rights reserved.

So, I may be missing something, but these are just the full universal TruSeq adapter and the reverse-complement of the Index1 adapter. (There is a list of all 12 Indexes as PCR primers.)

So, my guess is that the PPC contains all 6 oligos. One set of six for the "A" libraries and one set of six for the "B" libraries. Or, that I am wrong.

In any case, I don't see a down-side to your derivations of the sequences.

--
Phillip

[ETHANol]

That's a great idea to run denatured libraries on an RNA chip.

I remembered seeing the pooling instructions on some Illumina publication a while back but after searching I couldn't find it anywhere. But after some Googling I found it here from Agelient:

http://www.chem.agilent.com/Library/usermanuals/Public/G7530-90000_SureSelect_IlluminaXTMultiplexed_v.1.2.pdf

It seems like Illumina took it down for some reason.

What do you mean I can get the full set of sequences from my FAS. What/who is a FAS? I have a publication from Illlumina that has all their oligonucleotide sequences except the primers in the TruSeq PCR Primer Cocktail. Regardless whatever/whoever my FAS is here in Greece, I'm sure they are not giving me anything.

I'm not sure what you mean by the statement that Illumina is using the entire adapter as a PCR primer, including the barcode. That can not be possible since there is only one PCR Primer Cocktail (PPC) to be used with all the adapters, correct? I assume the PCR primers must be sort of short since the lowered the annealing temp in the PCR to 60˚C.

[pmiguel]

Looks fine to me.

You could QC them single stranded:

http://seqanswers.com/forums/showthread.php?t=12523

TruSeq appears to resolutely use the entire adapter as a PCR primer -- including the barcode itself. (You can get the full set of sequences from you FAS.)

BTW, where did you get the very useful Index pooling instructions? We ran into index pooling issues with this on our first run. Everyone we ran it by at Illumina seemed to completely oblivious to the obvious issue.
--
Phillip

[ETHANol]

After searching the web ways to barcode ChIP-seq libraries, it seems like the best option is to add a barcode at the end of the adaptors (Lefrancois et al 2009) but this requires you to make libraries in multiples of four and the invariant T I'm told may cause issues during sequencing. Illumina still has not released TruSeq for ChIP-seq so I put together a protocol which seems like it should work and uses the reagents we have from the previous ChIP-seq protocol. Illumina has released the adapter sequences but I had to take my best guess at the sequence of the PCR primers.

After spending a beautiful summer weekend in the lab dialing this protocol in, I get good amplification and a nice smear in the correct size range with only 11 cycles of PCR (total cycles from first and second PCR steps) and no self-ligated adaptors. So in theory it looks good.

Has anyone tried ChIP-seq with TruSeq primers? What's your opinion of the attached protocol? Do you think it will work or am I about to waste a thousand dollars on sequencing junk?

Any comments or improvements are appreciated.

A slightly updated version of the protocol is here

http://ethanomics.files.wordpress.com/2011/11/chip_truseq3.pdf

or if that changes check my blog at:

http://ethanomics.wordpress.com/

Attached file removed check the updated version on my blog.