We did 2X300 pair end sequence with Miseq to cover V1-V3 regions of 16srRNA. We use primer 27F (AGAGTTTGATCATGGCTCAG) for V1, and position 534-518 R (ATTACCGCGGCTGCTGG) for V3 regions.
Now, if I want to check V1 region only, I extract the reads have 27F primer:
grep "AGAGTTTGATCATGGCTCAG" Read1
grep "AGAGTTTGATCATGGCTCAG" Read2
Then keep the first 92bp for both read1/read2 as V1 region.
My question, do I need to consider reverse complimentary seq for 27F primer for both pair end reads? Am I right to extract from both paired read with same primer? Why my left reads (with V1 primer) from above have lots of V3 primer (over 30%)?
Is there recommend way to extract subregion for this pair end sequence, i.e V1 or V3 only with known design primer?
Thanks
Now, if I want to check V1 region only, I extract the reads have 27F primer:
grep "AGAGTTTGATCATGGCTCAG" Read1
grep "AGAGTTTGATCATGGCTCAG" Read2
Then keep the first 92bp for both read1/read2 as V1 region.
My question, do I need to consider reverse complimentary seq for 27F primer for both pair end reads? Am I right to extract from both paired read with same primer? Why my left reads (with V1 primer) from above have lots of V3 primer (over 30%)?
Is there recommend way to extract subregion for this pair end sequence, i.e V1 or V3 only with known design primer?
Thanks
Comment