Hi,
I hope this question does not sound to stupid. I have the following problem. I have NGS data from miRNA sequencing. I trimm the reads, so that I have a minimum length of 16nt and a maximum length of 35nt. I used bowtie (not bowtie2) to align/map the reads against a reference. My reference is a bowtie index, based on the human mature miRNAs taken from miRBase. In order to build the index and map the sequences after I exchanged all "U"s by "T"s.
My problem is that I have for example a read with the following sequence:
TCTCCCAACCCTTGTACCAGTGT
Bowtie tells me that this sequence does not match.If I blast it I find it to be mir-150-5p. The identitity is 100%.
My read is 1nt LONGER than the actual reference sequence (TCTCCCAACCCTTGTACCAGTG). Therefore bowtie does not find it. I tried different parameters for bowtie, but only manage to get it, if I shorten my read by 1 nt, which is of course not an option, as this is just a single example we found by random.
Do I make here any principle error? Is it impossible to map a read which is longer than the reference? Any suggestion? Do I need to "artifially" modify my mirBase sequences before I make an index? Like attaching 10Gs at both ends?
I hope this question does not sound to stupid. I have the following problem. I have NGS data from miRNA sequencing. I trimm the reads, so that I have a minimum length of 16nt and a maximum length of 35nt. I used bowtie (not bowtie2) to align/map the reads against a reference. My reference is a bowtie index, based on the human mature miRNAs taken from miRBase. In order to build the index and map the sequences after I exchanged all "U"s by "T"s.
My problem is that I have for example a read with the following sequence:
TCTCCCAACCCTTGTACCAGTGT
Bowtie tells me that this sequence does not match.If I blast it I find it to be mir-150-5p. The identitity is 100%.
My read is 1nt LONGER than the actual reference sequence (TCTCCCAACCCTTGTACCAGTG). Therefore bowtie does not find it. I tried different parameters for bowtie, but only manage to get it, if I shorten my read by 1 nt, which is of course not an option, as this is just a single example we found by random.
Do I make here any principle error? Is it impossible to map a read which is longer than the reference? Any suggestion? Do I need to "artifially" modify my mirBase sequences before I make an index? Like attaching 10Gs at both ends?
).

Comment