Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • miRNA-Seq files header and expression values

    I have downloaded miRNA seq file from GSE31617
    Files contain information like following:

    hsa-let-7a-1 hsa-let-7a t0000020 25073 37013 5p TGAGGTAGTAGGTTGTATAGTT TGAGGTAGTAGGTTGTATAGTT S
    hsa-let-7a-1 hsa-let-7a* t0059321 6 12 3p CTATACAATCTACTGTCTTTC CTATACAATCTACTGTCTTTC S
    hsa-let-7a-2 hsa-let-7a t0000020 25073 37025 5p TGAGGTAGTAGGTTGTATAGTT TGAGGTAGTAGGTTGTATAGTT S
    hsa-let-7a-2 hsa-let-7a-2* t1103419 1 1 3p CTGTACAGCCTCCTAGCTTTCC CTGTACAGCCTCCTAGCTTTCC S
    hsa-let-7a-3 hsa-let-7a t0000020 25073 37128 5p TGAGGTAGTAGGTTGTATAGTT TGAGGTAGTAGGTTGTATAGTT S
    hsa-let-7a-3 hsa-let-7a* t0059321 6 12 3p CTATACAATCTACTGTCTTTC CTATACAATCTACTGTCTTTC S
    hsa-let-7b hsa-let-7b t0000335 3748 7938 5p TGAGGTAGTAGGTTGTGTGGTT TGAGGTAGTAGGTTGTGTGGTT S
    hsa-let-7b hsa-let-7b* t0163422 2 2 3p CTATACAACCTACTGCCTTCC CTATACAACCTACTGCCTTCCC D
    hsa-let-7c hsa-let-7c t0000721 2095 3068 5p TGAGGTAGTAGGTTGTATGGTT TGAGGTAGTAGGTTGTATGGTT S
    hsa-let-7d hsa-let-7d* t0056459 6 18 3p CTATACGACCTGCTGCCTTTC CTATACGACCTGCTGCCTTTCT D
    hsa-let-7d hsa-let-7d t0004262 320 767 5p AGAGGTAGTAGGTTGCATAGTT AGAGGTAGTAGGTTGCATAGTT S


    First, I wanna know what is the header of columns? (files do not have any header line)
    Second, I would like to calculate expression values for miRNAs, how can I do it?
    Thanks

    PS. I am new in miRNAseq files.

  • #2
    For ref Cross-posted: https://www.biostars.org/p/165320/

    I am thinking that it is some sort of alignment format but the exact name is eluding me (and my google-fu for now). Hopefully some one else will be able to recollect.

    Where exactly did you get that data file from on SRA?
    Last edited by GenoMax; 11-11-2015, 09:21 AM.

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Multiomics Techniques Advancing Disease Research
      by seqadmin


      New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

      A major leap in the field has
      ...
      02-08-2024, 06:33 AM
    • seqadmin
      The 3D Genome: New Technologies and Emerging Insights
      by seqadmin


      The study of three-dimensional (3D) genomics explores the spatial structure of genomes and their role in processes like gene expression and DNA replication. By employing innovative technologies, researchers can study these arrangements to discover their role in various biological processes. Scientists continue to find new ways in which the organization of DNA is involved in processes like development1 and disease2.

      Basic Organization and Structure
      Understanding...
      01-22-2024, 03:25 PM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, Today, 08:57 AM
    0 responses
    11 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-14-2024, 09:19 AM
    0 responses
    42 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-12-2024, 03:37 PM
    0 responses
    406 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 02-09-2024, 03:36 PM
    0 responses
    647 views
    0 likes
    Last Post seqadmin  
    Working...
    X