I’m in the middle of 4C-seq experiment and now designing primers for final PCR. I did it according to van de Werken protocol (Meth. Enzymol., 2012, 513, 89-112) and my final library structure is expected to be as follows (1):
5’AATGATACGGCGACCACCGANNNPPPPPPPPPPPPPPAAGCTT<INSERT>PPPPPPPPPPPPPPPPPPPPATCTCGTATGCCGTCTTCTGCTTG
where from 5': Illumina P5 primer, NNN – trinucleotide index to sort libraries (16 libraries should be sequenced in one run), PPPPP – viewpoint primers, and at 3’ end – the Illumina P7 primer, reverse complemented. Length of each primer is about 43 n.
The libraries are planned to be sequenced (single end) using Illumina 2500. If I properly understand the technology, after bridge PCR and removing of the P5-anchored fragments, the residual fragments attached to support through P7 will contain the reverse complemented P5 primer at their free ends and are sequenced from P5 primer.
However, when I discussed this experiment with our local NGS people, I was told that this library structure will not work and I will need custom sequencing primers, and proposed what they call universal adapters. With these adapters, the library structure (without viewpoint primers) should be as shown below (2):
5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-INSERT-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG-3’
I don’t like this structure very much, because it has 60 n adapters, and with addition of my viewpoint primers they will become as long as ~80 n. To add these adapters it will be necessary to use nested PCR, and I would like to minimize the number of PCR cycles.
So my question is could the libraries with the structure (1) be sequenced using HiSeq 2500 with Illumina P5 primer, or it is necessary to use the universal adapters to prepare libraries with structure (2)?
Thanks a lot.
5’AATGATACGGCGACCACCGANNNPPPPPPPPPPPPPPAAGCTT<INSERT>PPPPPPPPPPPPPPPPPPPPATCTCGTATGCCGTCTTCTGCTTG
where from 5': Illumina P5 primer, NNN – trinucleotide index to sort libraries (16 libraries should be sequenced in one run), PPPPP – viewpoint primers, and at 3’ end – the Illumina P7 primer, reverse complemented. Length of each primer is about 43 n.
The libraries are planned to be sequenced (single end) using Illumina 2500. If I properly understand the technology, after bridge PCR and removing of the P5-anchored fragments, the residual fragments attached to support through P7 will contain the reverse complemented P5 primer at their free ends and are sequenced from P5 primer.
However, when I discussed this experiment with our local NGS people, I was told that this library structure will not work and I will need custom sequencing primers, and proposed what they call universal adapters. With these adapters, the library structure (without viewpoint primers) should be as shown below (2):
5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-INSERT-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG-3’
I don’t like this structure very much, because it has 60 n adapters, and with addition of my viewpoint primers they will become as long as ~80 n. To add these adapters it will be necessary to use nested PCR, and I would like to minimize the number of PCR cycles.
So my question is could the libraries with the structure (1) be sequenced using HiSeq 2500 with Illumina P5 primer, or it is necessary to use the universal adapters to prepare libraries with structure (2)?
Thanks a lot.