Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • crh
    Member
    • Dec 2009
    • 46

    sorting sam file

    Hi All,

    I've read the archives and see where this problem has been addressed previously, but I've been unable to sort a sam file to feed into cufflinks.
    Here is an excerpt from the sam file:



    @SQ SN:chromosome_1 LN:9982135
    @SQ SN:chromosome_2 LN:9975745
    @SQ SN:chromosome_3 LN:7773333
    @SQ SN:chromosome_4 LN:3005669
    @SQ SN:chromosome_5 LN:3366352
    @SQ SN:chromosome_6 LN:7695193
    @SQ SN:chromosome_7 LN:6170768
    @SQ SN:chromosome_8 LN:4189090
    @SQ SN:chromosome_9 LN:4733070
    @SQ SN:chromosome_10 LN:6579462
    @SQ SN:chromosome_11 LN:2734619
    @SQ SN:chromosome_12 LN:9355449
    @SQ SN:chromosome_13 LN:6588689
    @SQ SN:chromosome_14 LN:4114342
    @SQ SN:chromosome_15 LN:3066274
    @SQ SN:chromosome_16 LN:6617689
    @SQ SN:chromosome_17 LN:6673064
    @SQ SN:scaffold_18 LN:1287285
    @SQ SN:scaffold_19 LN:814470
    @SQ SN:scaffold_20 LN:598575
    @SQ SN:scaffold_21 LN:558747
    @SQ SN:scaffold_22 LN:430403
    @SQ SN:scaffold_23 LN:373397
    @SQ SN:scaffold_24 LN:339605
    @SQ SN:scaffold_25 LN:333029
    @SQ SN:scaffold_26 LN:317769
    @SQ SN:scaffold_27 LN:256895
    @SQ SN:scaffold_28 LN:253209
    @SQ SN:scaffold_29 LN:245379
    @SQ SN:scaffold_30 LN:238238
    @SQ SN:scaffold_31 LN:222931
    @SQ SN:scaffold_32 LN:217100
    @SQ SN:scaffold_33 LN:214180
    @SQ SN:scaffold_34 LN:186456
    @SQ SN:scaffold_35 LN:179663
    @SQ SN:scaffold_36 LN:154127
    @SQ SN:scaffold_37 LN:123055
    @SQ SN:scaffold_38 LN:120767
    @SQ SN:scaffold_39 LN:119177
    @SQ SN:scaffold_40 LN:116725
    @SQ SN:scaffold_41 LN:99905
    @SQ SN:scaffold_42 LN:98780
    @SQ SN:scaffold_43 LN:80533
    @SQ SN:scaffold_44 LN:80252
    @SQ SN:scaffold_45 LN:79195
    @SQ SN:scaffold_46 LN:72145
    @SQ SN:scaffold_47 LN:67355
    @SQ SN:scaffold_48 LN:66577
    @SQ SN:scaffold_49 LN:65629
    @SQ SN:scaffold_50 LN:63401
    @SQ SN:scaffold_51 LN:63266
    @SQ SN:scaffold_52 LN:59018
    @SQ SN:scaffold_53 LN:55340
    @SQ SN:scaffold_54 LN:54374
    @SQ SN:scaffold_55 LN:50490
    @SQ SN:scaffold_56 LN:47028
    @SQ SN:scaffold_57 LN:46469
    @SQ SN:scaffold_58 LN:45221
    @SQ SN:scaffold_59 LN:43590
    @SQ SN:scaffold_60 LN:43313
    @SQ SN:scaffold_61 LN:39687
    @SQ SN:scaffold_62 LN:38880
    @SQ SN:scaffold_63 LN:36644
    @SQ SN:scaffold_64 LN:36299
    @SQ SN:scaffold_65 LN:36037
    @SQ SN:scaffold_66 LN:32450
    @SQ SN:scaffold_67 LN:30996
    @SQ SN:scaffold_68 LN:29908
    @SQ SN:scaffold_69 LN:29423
    @SQ SN:scaffold_70 LN:28937
    @SQ SN:scaffold_71 LN:28038
    @SQ SN:scaffold_72 LN:26265
    @SQ SN:scaffold_73 LN:25979
    @SQ SN:scaffold_74 LN:25574
    @SQ SN:scaffold_75 LN:25288
    @SQ SN:scaffold_76 LN:23213
    @SQ SN:scaffold_77 LN:22385
    @SQ SN:scaffold_78 LN:21742
    @SQ SN:scaffold_79 LN:21191
    @SQ SN:scaffold_80 LN:20468
    @SQ SN:scaffold_81 LN:20314
    @SQ SN:scaffold_82 LN:20067
    @SQ SN:scaffold_83 LN:18413
    @SQ SN:scaffold_84 LN:15458
    @SQ SN:scaffold_85 LN:13564
    @SQ SN:scaffold_86 LN:12875
    @SQ SN:scaffold_87 LN:12675
    @SQ SN:scaffold_88 LN:8671
    USI-EAS39:1:1:2:1362#0/1_3[0] 65 chromosome_2 28825 30 35M * 0 0 CTGGGTTCCACAGGCACATAGCCAAACCGGTGCCT ``]XD\a``b`b`^aa`aaaa`a]^aaa\UZ^^a^ NM:i:1 MD:Z:4T30
    USI-EAS39:1:1:2:1276#0/1_3[0] 65 chromosome_12 6073621 30 35M * 0 0 GTTCGCTTTACACCGTAACATATTCAGCCAAATGC ]_aWDK\bbaaba_Y]ababbaaa`ba`abbab]` NM:i:0 MD:Z:35
    USI-EAS39:1:1:2:1649#0/1_3[0] 81 chromosome_17 6301050 30 35M * 0 0 GCTCCAACAACAAGACCTCCTGACATAAGACTCAC ^`_a`a`P__Xaaa]_X^``aa`bbbbba^D[a^a NM:i:1 MD:Z:30G4


    I generated the sam file using:
    samtools view -h -S -t ~/binf/seq/genome/chlre4/Chlre4_genomic_scaffolds.fasta.fai -o test_sorted.sam soap_mapped_reads.sam

    If I run cufflinks, I get the error:

    cufflinks -G ~/binf/sto1/models.gtf test_sorted.sam

    [bam_header_read] EOF marker is absent.
    [bam_header_read] invalid BAM binary header (this is not a BAM file).
    File test_sorted.sam doesn't appear to be a valid BAM file, trying SAM...
    [23:01:46] Loading reference annotation.
    [23:01:51] Inspecting reads and determining fragment length distribution.
    > Processing Locus chromosome_17:6295360-62958 [**** ] 18%
    Error: this SAM file doesn't appear to be correctly sorted!
    current hit is at chromosome_15:2745584, last one was at chromosome_17:6301049
    Cufflinks requires that if your file has SQ records in
    the SAM header that they appear in the same order as the chromosomes names
    in the alignments.
    If there are no SQ records in the header, or if the header is missing,
    the alignments must be sorted lexicographically by chromsome
    name and by position.


    So, the sam file is not correctly sorted.
    If I sort using:
    sort -k 3,3 -k 4,4n test_sorted.sam > test2_sorted.sam

    I loose the header, and get the same error when attempting to run cufflinks:
    [23:08:38] Loading reference annotation.
    [23:08:43] Inspecting reads and determining fragment length distribution.
    > Processing Locus scaffold_88:8392-8579 [************************ ] 98%
    Error: this SAM file doesn't appear to be correctly sorted!
    current hit is at scaffold_82:5078, last one was at scaffold_81:18777
    Cufflinks requires that if your file has SQ records in


    I guess the question is how to sort 'chromosome_1'?

    charles
  • peromhc
    Senior Member
    • Sep 2009
    • 108

    #2
    I had a, identical error message when I had colons ":" in my original fasta file.. I'd check that if I were you!

    Comment

    • crh
      Member
      • Dec 2009
      • 46

      #3
      I've checked, and there are no colons within the genomic fasta file
      charles

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM
      • GATTACAT
        Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
        by GATTACAT
        Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
        07-01-2026, 11:43 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, Yesterday, 10:26 AM
      0 responses
      11 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-09-2026, 10:04 AM
      0 responses
      25 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-08-2026, 10:08 AM
      0 responses
      16 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-07-2026, 11:05 AM
      0 responses
      33 views
      0 reactions
      Last Post SEQadmin2  
      Working...