Parse Web Blast Output

[empyrean]

I have installed NCBI wwwblast at our local server and blast is running absolutely fine. I wanted to refine the html output which the blast is showing. For example, while showing alignment description, i wanted to make the "Subjcet" as a hyperlink and guide it to show in gbrowse. Can anyone suggest me how to achieve this?

For example, the default output is shown below.

   >gb|FJ032364.1| hypothetical resistant gene, complete
           cds
          Length = 1905

 Score =  634 bits (320), Expect = e-179
 Identities = 320/320 (100%)
 Strand = Plus / Plus


Query: 1   atgaatagtgtattgaatactggaagaactactatttgtgatgcgtataatgtagcggct 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   atgaatagtgtattgaatactggaagaactactatttgtgatgcgtataatgtagcggct 60

I would like to see "Sbjct:" as a hyperlink created by me. I have the www libraries but dont know which one to change this.. Please some one suggest me