Problem generating consensus files

[EmmaB]

Hello all,

I have been having trouble generating consensus files from sorted BAM files.

I have tried both the mpileup command-

samtools mpileup -uf ./genomes/NC_013316.fna 2245.sorted.bam | ../samtools-0.1.16/bcftools/bcftools view -cg - | ../samtools-0.1.16/bcftools/vcfutils.pl vcf2fq > 2245cns.fq

and the depreciated pileup command -

samtools pileup -cf ./genomes/NC_013316.fna 2245.sorted.bam | ../samtools-0.1.16/misc/samtools.pl pileup2fq -D150 > 2245pcns.fastq

Both commands run correctly, however when I look at the fastq file it truncates at line 69857 and the rest of the files is filled with this character ( ~~~~) and random letters, as shown below -

TCCATAAATTTAGTTATTCTGTAAAATTTATATATATTTTTGCTTTTCTGTTAATAACTT
TGTGGAAAATATTAATTATTCTGTTCGGAGGTTTATatt
+
?BBEEEEHNNNNNZZ`ccffiiloru~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Can anyone please explain what may be going on?
I am very new to seq analysis and can't work it out!

Emma

[EmmaB]

please ignore the last post!

PLease ignore the last post, I have just realised that I have not converted my file to fasta, therefore I still have the quality called in the fastq file!

[leirhyh]

samtools to convert Bam file to consensus sequence

Hi, all:
I tried to covert Bam file to consensus sequence as follow command:

Samtools pileup -cf primatecom-sorted.bam samtools.pl pileup2fq -D100 > primate.fa

error as follows:
the Pileup command has been removed. please use mpileup instead.

according to EmmBB, I tried mpileup. However, I didn't find samtools-0.1.18/bcftools/bcftools.

Could you help me for this matter?

Thank you very much,

Runhua