Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • SAM validation errors

    Hi,

    I need some help understanding these errors when I use picard to validate a SAM/BAM file:


    $java -jar picard-tools-1.50/ValidateSamFile.jar I=somebam.bam
    ERROR: Read groups is empty
    ERROR: Record 38, Read name V15-13:3:73:1694:1074, CIGAR should have zero elements for unmapped read.
    ERROR: Record 37, Read name V15-13:3:73:1694:1074, Mate negative strand flag does not match read negative strand flag of mate

    What does this error mean? I understand why an unmapped read should have zero elements in the CIGAR string, but reads at records 37 and 38 seem to be mapped. Can someone help me understand this error? These are the corresponding records from the SAM file:

    V15-13:3:73:1694:1074 89 chr1 325709 0 69S46M = 325709 0 GTGGCTGACTATGGAAGCCCAAGTCTTCCTCAAATCCGGCTTTTGCCCAACTTCTGACTACTGTCGGACTCTACAGGTCAGCCTCTGCCTCACAGTGGACCCTCCAGACCCAGAT ######################################################################CA,ECEA<EC>AA+BAABB+EC4EGGGGDD<D8BFGDDGGGGGEG XC:i:46 XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:5 X1:i:13 XM:i:0 XO:i:0 XG:i:0 MD:Z:46

    V15-13:3:73:1694:1074 181 chr1 325709 0 58M57S = 325709 0 TTCTGGCAGGAGGACTTTTGGCGCCGACATTGGCCGCCAGGCGCTAGACAGGCCCTGGGCCAAAAAAGGCTGTTGTTAGGCAGCGGTTGTGCCGGTGGCCCCAGCCAAGAGGAAG ##########################################################??37B<?35991*9773,+>8@=7>228?B,B775''=-B,BDDGG?EB:F=?@BEE XC:i:58

    Thanks!
    -- Ashwatha.

  • #2
    READ: V15-13:3:73:1694:1074
    FLAG: 89
    (read paired, mate unmapped, read reverse strand, first in pair)



    RNAME: chr1

    MRNM: = (? that should not be)

    READ: V15-13:3:73:1694:1074 (mate)
    FLAG: 181
    (read paired, read unmapped, read reverse strand, mate reverse strand, second in pair)

    RNAME: chr1 (? but this read in not mapped)


    you can fix them using FixMateInformation of Picard, otherwise use VALIDATION_STRINGENCY=SILENT

    Comment


    • #3
      Thank you for the help.

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Exploring the Dynamics of the Tumor Microenvironment
        by seqadmin




        The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
        07-08-2024, 03:19 PM
      • seqadmin
        Exploring Human Diversity Through Large-Scale Omics
        by seqadmin


        In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
        06-25-2024, 06:43 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 07-16-2024, 05:49 AM
      0 responses
      24 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 07-15-2024, 06:53 AM
      0 responses
      31 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 07-10-2024, 07:30 AM
      0 responses
      40 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 07-03-2024, 09:45 AM
      0 responses
      205 views
      0 likes
      Last Post seqadmin  
      Working...
      X