In running UnifiedGenotyper in GATK, I got the following error message:
Exception in thread "main" net.sf.samtools.SAMFormatException: SAM validation error: ERROR: Record 5248502, Read name FCD0CALABXX:1:1104:13631:110790#CTTGTAAT, MAPQ should be 0 for unmapped read.
at net.sf.samtools.SAMUtils.processValidationErrors(SAMUtils.java:334)
at net.sf.samtools.BAMFileReader$BAMFileIterator.advance(BAMFileReader.java:469)
... and a bunch more of these error messages that start with "at". I interpret this message as saying that a read at line 5248502 named " FCD0CALABXX:1:1104:13631:110790#CTTGTAAT " is unmapped but has a mapping quality score of that is not 0. However, if I look at the sam file that corresponds to the bam file, I find that there are two reads named "FCD ....", one at line 5248502 and one at the previous line, both of them are mapped and both of them have mapping quality scores that are non-zero:
line 5248501:
FCD0CALABXX:1:1104:13631:110790#CTTGTAAT 83 chrM 226 29 90M chr9_gl000201_random 36145 0 TAGGACATAATAATAACAATTGAATGTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAAAATTTCCACCAAACCCCCCCTCCCCC ^_cW[`UbacaecbeO]]TUababdbTa^[cGcc``c[adecagdgdgggegbeggdgggggfegeefeffXfffg[gggggggeggggf XT:A:U NM:i:2 SM:i:29 AM:i:29 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:84C0T4
line 5248502:
FCD0CALABXX:1:1104:13631:110790#CTTGTAAT 167 chr9_gl000201_random 36145 29 41S49M chrM 226 0 AGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCA gggggggggggggggggggggggggggggggg_gggeeggggagggegegfggggg\cfgdggggegfggggggggdfag[eefefeefe XT:A:M NM:i:1 SM:i:29 AM:i:29 XM:i:1 XO:i:0 XG:i:0 MD:Z:3C45
Both of them have somewhat weird chromosomes, but both of those chromosomes are in my fasta genome data base, so that should be fine. Does anyone see what I'm doing wrong?
Thanks.
Eric
Exception in thread "main" net.sf.samtools.SAMFormatException: SAM validation error: ERROR: Record 5248502, Read name FCD0CALABXX:1:1104:13631:110790#CTTGTAAT, MAPQ should be 0 for unmapped read.
at net.sf.samtools.SAMUtils.processValidationErrors(SAMUtils.java:334)
at net.sf.samtools.BAMFileReader$BAMFileIterator.advance(BAMFileReader.java:469)
... and a bunch more of these error messages that start with "at". I interpret this message as saying that a read at line 5248502 named " FCD0CALABXX:1:1104:13631:110790#CTTGTAAT " is unmapped but has a mapping quality score of that is not 0. However, if I look at the sam file that corresponds to the bam file, I find that there are two reads named "FCD ....", one at line 5248502 and one at the previous line, both of them are mapped and both of them have mapping quality scores that are non-zero:
line 5248501:
FCD0CALABXX:1:1104:13631:110790#CTTGTAAT 83 chrM 226 29 90M chr9_gl000201_random 36145 0 TAGGACATAATAATAACAATTGAATGTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAAAATTTCCACCAAACCCCCCCTCCCCC ^_cW[`UbacaecbeO]]TUababdbTa^[cGcc``c[adecagdgdgggegbeggdgggggfegeefeffXfffg[gggggggeggggf XT:A:U NM:i:2 SM:i:29 AM:i:29 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:84C0T4
line 5248502:
FCD0CALABXX:1:1104:13631:110790#CTTGTAAT 167 chr9_gl000201_random 36145 29 41S49M chrM 226 0 AGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCA gggggggggggggggggggggggggggggggg_gggeeggggagggegegfggggg\cfgdggggegfggggggggdfag[eefefeefe XT:A:M NM:i:1 SM:i:29 AM:i:29 XM:i:1 XO:i:0 XG:i:0 MD:Z:3C45
Both of them have somewhat weird chromosomes, but both of those chromosomes are in my fasta genome data base, so that should be fine. Does anyone see what I'm doing wrong?
Thanks.
Eric
Comment