how to use samtools to get consensus sequence?
see #2
edited.
edited.
-
-
my command line:
samtools mpileup -uf [ref] [aln.bam] | /bcftools/bcftools view -cg - | /bcftools/vcfutils.pl vcf2fq > [result.fq]
the result shows :
@gi|110645304|ref|NC_002516.2|
GCGTCGGCCTGGGCAAGACCCACCTGATGCATGCGGTGGGCAACCACCTGCTGAAGAAGA
ACCCGAACGCCAAGGTGGTTTACCTGCATTCGGAACGTTTCGTCGCGGACATGGTGAAGG
+
....
i want to split the consensus seq to contigs at the point with 0-coverage. how may i determine the coverage of each base in the file?
and i dont want any ambiguous base, is that possible to play with parameters to achieve that? what does N or n mean in the sequence? is that gaps or 0-coverage?
thx for reply!
-
Tumors contain complex mixtures of cell populations that evolve in response to treatment and host-specific factors. Tissue biopsies provide only static snapshots of a tumor’s state. But what if we could follow that evolution over time using a minimally invasive technique?
Liquid biopsies can detect tumor-derived material circulating in the bloodstream, providing a way to study treatment response, detect emerging resistance, and discover new biomarkers. Circulating...10-14-2026, 09:55 AM -
Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.
We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing...
Comment