Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • kevlim83
    Junior Member
    • Jan 2010
    • 9

    #1

    BWA pe alignment, sampe, proper pair

    Hi,

    I am trying to align a set of paired-end reads using bwa. I understand that the flags tell us whether a pair is mapped and proper. i.e. one on the forward strand and one on the reverse strand, and also within insert estimate.

    Now the problem is that most of my flags are 97,145,81,161.

    This really means one is mapped to forward and the other to reverse. I also manually checked insert size is within 5 stdev from the mean (according to the bwa output, the maximum inferred insert is 5.88 from mean, so i assume anything within 5.88 stdev is a concordant read). This means the pair should be proper? But why is the flag=2 not set? i.e. I expected to get flags 99,147,83,163 instead of 97,145,81,161.

    Here is an example of my alignment results:
    >test1 97 chr2 1941945 37 27M = 1940790 -1128 AAAAAAAAGCCCCGCCGACATTTCCAC ~~~~~~~~~~~~~~~~~~~~~~~~~~~ XT:A:U NM:i:1 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:0G26
    >test1 145 chr2 1940790 37 27M = 1941945 1128 CTGCAGCAGCACGTTCTGCATTTCCTT ~~~~~~~~~~~~~~~~~~~~~~~~~~~ XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:27

    The mean insert size is 1250 and stdev is 46, maximum inferred insert is 5.88 stdev from mean (as reported by bwa). So, 1128 should be within the range for concordant.

    Does anyone knows why an alignment like this is not considered proper? i.e. why is flag=2 not set?

    Regards,
    Kevin
  • kevlim83
    Junior Member
    • Jan 2010
    • 9

    #2
    Anyone with ideas? Please help. Thanks!

    Comment

    • valei
      Member
      • Sep 2010
      • 14

      #3
      You are right.
      I think the problem is the follow: If the first read (with flag 97) refers to forward strand, the second read must be downstream. It's not possible that the second read is at position -1128.

      Comment

      • swbarnes2
        Senior Member
        • May 2008
        • 910

        #4
        Your reads are running away from each other, bwa apparently only calls them proper if they run into each other, like normal paired-end reads do.

        bwa wants this:

        ---> <---

        Your mate-pair reads are doing this:

        <--- --->

        Comment

        Latest Articles

        Collapse

        • SEQadmin2
          Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
          by SEQadmin2



          CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

          Despite this, “CRISPR helped turn genome editing from a specialized technique into
          ...
          07-31-2026, 11:01 AM
        • SEQadmin2
          Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
          by SEQadmin2


          Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

          The systematic characterization of the human proteome has
          ...
          07-20-2026, 11:48 AM
        • SEQadmin2
          Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
          by SEQadmin2



          Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
          ...
          07-09-2026, 11:10 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by SEQadmin2, Yesterday, 10:13 AM
        0 responses
        13 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-31-2026, 02:55 AM
        0 responses
        26 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-24-2026, 12:17 PM
        0 responses
        20 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-23-2026, 11:41 AM
        0 responses
        19 views
        0 reactions
        Last Post SEQadmin2  
        Working...