Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • merge paired end

    Hi,

    How can I merge two paired end fastq (R and L) to give a single fastq file ?



    Thanks,

    N.
    Last edited by NicoBxl; 10-13-2011, 01:41 AM.

  • #2
    For example here's two paired reads :



    Code:
    @HWUSI-EAS529:41:FC62YHFAAXX:8:1:7969:1330 1:N:0:GCCAAT
    CTACGAAAGGGCACTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCT
    +
    IIIIIIIHIIHIIIIIIHHIIIHGIIIIEIIIIIIEIIHIIIIIIIIIIIHIIIIIBHIHIIHGIGIEGHHEGEEH


    Code:
    @HWUSI-EAS529:41:FC62YHFAAXX:8:1:7969:1330 2:N:0:GCCAAT
    AGTGCCCTTTCGTAGGATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA
    +
    IIIIIIIIIIIIIIIIIIIIIIIDHIGIIIHIIIGHGIIIIIIIHHIHIIIIIIIIIHIIIIIIIIHIIGIIIIHI
    I find the adapter in the first one :

    Code:
    EMBOSS_001         1 CTACGAAAGGGCACTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGC     50
                                        |||||||||||||||||||||              
    EMBOSS_001         1 ---------------TGGAATTCTCGGGTGCCAAGG--------------     21
    
    EMBOSS_001        51 CAATATCTCGTATGCCGTCTTCTGCT     76
                                                   
    EMBOSS_001        22 --------------------------     21
    but not in the second one ...

    Comment


    • #3
      The velvet assembler comes with shuffleSequences perl scripts that do that will do that for fasta or fastq files.

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Latest Developments in Precision Medicine
        by seqadmin



        Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

        Somatic Genomics
        “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
        05-24-2024, 01:16 PM
      • seqadmin
        Recent Advances in Sequencing Analysis Tools
        by seqadmin


        The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
        05-06-2024, 07:48 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 05-24-2024, 07:15 AM
      0 responses
      198 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 05-23-2024, 10:28 AM
      0 responses
      220 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 05-23-2024, 07:35 AM
      0 responses
      229 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 05-22-2024, 02:06 PM
      0 responses
      13 views
      0 likes
      Last Post seqadmin  
      Working...
      X