mpileup to generate the names of reads covering a site?

[charlie_sequencing]

Hi everyone, I am using mpileup to generate alignment information for each site covered by reads, and wondering if there is a way of also getting the names of reads that cover a given site.

For example, the following shows a site that is covered by 4 reads. Is there a way of finding out what exactly the names of those 4 reads are? Thanks a lot!

Group1.1 5813 T 4 .,,, aadd

[swbarnes2]

Use samtools view on your .bam with a region that is 1 bp. That should give you the .sam entry for all reads crossing that spot.

[charlie_sequencing]

Use samtools view on your .bam with a region that is 1 bp. That should give you the .sam entry for all reads crossing that spot.

Thank you very much for your reply, swbarnes2! I just tried "samtools view sample-sorted.bam" and what I got looked like the typical sam file. Here is one of the lines:

HWUSI-EAS594-R_0059:2:30:11702:12812#GGCTAC 16 Group1.1 211285 255 100M * 0 0 TATTAAACTATTATCCGCGTCAAATATTTCTAAGATGTTTATTACATCGTCAATACAAACAAAAATAGAAAAAAAATGTGAAAAAAACATGACTCACCGA bc\bcdddddbbbba`dad`afdfdfdddeddffeddedffffdffdedeffffffeffffffffWfeffffffffdfffffffffeff\fffefdffff NM:i:0 NH:i:1

Actually I am thinking if I can get an output which is similar to "Group1.1 5813 T 4 .,,, aadd" but includes an additional column containing the names of the reads from which those read bases ".,,," come from. I am wondering if you have tried any samtools command line that worked?

[swbarnes2]

Running samtools view without specifying a region will convert the whole thing to .sam. If you'd run "samtools view my bam Group1.1:5813-5814", with a region speficied, you should get just the entries that cross that point. BEDTools could do the same thing.