Scripting help to identify adaptors in reads

[Giorgio C]

Hi everybody,

i have some reads (454) where there are adaptors (NNNN...), one,two or three adaptors for each reads depending on the reads. Is there any way to establish for exemple how many reads have 1 adaptors, how many 2 and how many 3 adaptors over the total ???

>271-88
GCCTTGCCAGCCGCTCAGATTGATNNNNNNNNNNNNNNNATCAGGTGCCTACG
>272-88
GCCTTGCCAGCCGCTCAGATTGATNNNNNNNNNNNNNNNATCANNNNNNNNNNNNNNNCTGATGGCGCGAGGGAGGCGCCTTGCCAGCCCGCTCAGATTGATNNNNNNNNNNNNNNNCTGATGGCGCGAGGGAGGC
>273-88
GCCTCCCTCGCGCATCAGATCGTAGGCACCATCAATCTGAGCGGGCTGGCAAGGCGCCTCCCTCGCGCCA
>274-88
GCCTTGCCAGCCGCTCAGATTGATNNNNNNNNNNNNNNNCTGATGGCGCGAGGGAGGCGCCTCCCTCGCGCCATCAGATCGTNNNNNNNNNNNNNNNNNNTCGTAGGCACCATCAATCTGAGCGGGCTGGCAAGGCGCCTCCCTCGCGCCATCAGATCGTAGGCACCATCAA

Can anyone suggests me a script to fix this ???

Thank you very much

[maasha]

You could run a couple of rounds of find_adaptor - which is pretty clever - from Biopieces (www.biopieces.org).

[Giorgio C]

Thank you it's a very good tool. But the problem is that some adpators occur in the middle of the sequences because they coming out from a concameration experimental design (they are miRNAs between NNNNNN...). So i want to know a script or tool that may say how many reads have 1 adapt, how many 2, (max are 4) in respect to the total number of reads. Do you know any tool/script that may help ? Tnx

[maasha]

Hm, perhaps patscan_seq then:

read_fasta -i data.fna | patscan_seq -ip "p1=<adaptor sequence> 0...50 p1 0...50 p1 0...50 p1" | write_fasta -xo got4_adaptors.fna

read_fasta -i data.fna | patscan_seq -ip "p1=<adaptor sequence> 0...50 p1 0...50 p1" | write_fasta -xo got3_adaptors.fna

etc

of cause you need to separate the sequences in piles. Clever use of grab should do that.

Martin

[Giorgio C]

Wonderful Thanks !!!

[maasha]

of cause you could perhaps also use REGEX of some sort. egrep, agrep or nrgrep springs to mind. you could also use grab --regex in Biopieces.

[Giorgio C]

Thanks maasha,

another rapid way:

nawk -F'[N]+' '/^[^>]/{a[NF-1]++}END{for(i in a) print a[i] " have " i " ADAPTOR"}' myFile.fasta > result.txt

[Giorgio C]

Also in perl with the same result:

perl -ne '$count{s/N+//g}++ if /^[^>]/;END{for $i (keys %count){print "$count{$i} have $i ADAPTOR\n";}}' myFile.fasta > result.txt