Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Short-read quality control software.

    Hi everyone,
    I would like to know which are the most useful softwares to control the quality of short reads generated by different kinds of platform.
    I've just used FastQC but it's just a visual tool.
    Do anyone know similar softwares that make similar analisys, provide some informations about bad reads and filter them?
    Thanks

  • #2
    I have recently started using a combination of cutadapt and prinseq that seems to be working pretty well. Here's an example command that will trim all TruSeq adapters and low quality bases

    gunzip *.gz -c | cutadapt -O 6 2> reads.cutadap_log.txt -a AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG -a CTTCACCGTGCCAGACTAGAGTCAAGCTCAACAGGGTCTTCTTTCCCCGCTG -a GGATGAACGAGATTCCCACTGTCCCTACCTACTATCCAGCGAAACCACAGCC -a CTCCCTTTCGATCGGCCGAGGGCAACGGAGGCCATCGCCCGTCCCTTCGGAA -a CGAGATTCCCACTGTCCCTACCTACTATCCAGCGAAACCACAGCCAAGGGAA -a CCACTCTCGACTGCCGGCGACGGCCGGGTATGGGCCCGACGCTCCAGCGCCA -a TGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAAC -a CCTATACCCAGGTCGGACGACCGATTTGCACGTCAGGACCGCTACGGACCTC -a CACGAGCGCACGTGTTAGGACCCGAAAGATGGTGAACTATGCCTGGGCAGGG -a GTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCC -a CTCCCGTCCACTCTCGACTGCCGGCGACGGCCGGGTATGGGCCCGACGCTCC -a CGCAGGTTCAGACATTTGGTGTATGTGCTTGGCTGAGGAGCCAATGGGGCGA -a GAACGAGATTCCCACTGTCCCTACCTACTATCCAGCGAAACCACAGCCAAGG -a CAGAAGGGCAAAAGCTCGCTTGATCTTGATTTTCAGTACGAATACAGACCGT -a TTTCGATCGGCCGAGGGCAACGGAGGCCATCGCCCGTCCCTTCGGAACGGCG - | prinseq -fastq stdin -out_good stdout -log reads.prinseq_log.txt -min_len 20 -ns_max_n 4 -min_gc 10 -max_gc 90 -min_qual_mean 18 -trim_qual_left 10 -trim_qual_right 10 | gzip -9 > reads.trimmed.fastq.gz

    Comment


    • #3
      Originally posted by desmo View Post
      Hi everyone,
      I would like to know which are the most useful softwares to control the quality of short reads generated by different kinds of platform.
      I've just used FastQC but it's just a visual tool.
      Do anyone know similar softwares that make similar analisys, provide some informations about bad reads and filter them?
      Thanks
      I would be wary about automatically filtering anything which looked odd in a dataset. Some filtering (quality and adapter trimming) is uncontentious and programs like cutadapt seem to do a good enough job for that. Filtering on other measures within your library without actually looking at the data and putting this in the context of the experiment runs the risk of removing interesting biological effects.

      We've always said that the tests in FastQC are not intended to tell you whether your data is good or bad, they're there to tell you which aspects of your data you need to consider more closely, or bear in mind when interpreting the results of downstream analysis. We can provide examples of perfectly good sequence data which can fail any of the tests FastQC does.

      Comment


      • #4
        Thanks. I've not yet decided what strategy is better for my work but yours suggestions were very useful

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Best Practices for Single-Cell Sequencing Analysis
          by seqadmin



          While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
          06-06-2024, 07:15 AM
        • seqadmin
          Latest Developments in Precision Medicine
          by seqadmin



          Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

          Somatic Genomics
          “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
          05-24-2024, 01:16 PM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, 06-14-2024, 07:24 AM
        0 responses
        12 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-13-2024, 08:58 AM
        0 responses
        13 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-12-2024, 02:20 PM
        0 responses
        17 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-07-2024, 06:58 AM
        0 responses
        184 views
        0 likes
        Last Post seqadmin  
        Working...
        X