Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • dongshenglulv
    Member
    • May 2011
    • 15

    #1

    error in picard (SAM validation error)

    Hi, I had a error message when I use picard to replace read groups in a BAM file, like this:

    $ java -jar AddOrReplaceReadGroups.jar I=SRX020270.sorted.bam O=SRX020270.resorted.bam SORT_ORDER=coordinate RGID=SRX020270 RGLB=bar RGPL=illumina RGSM=SRX020270 RGPU='run barcode' CREATE_INDEX=True

    [Sat Nov 19 13:17:11 CST 2011] net.sf.picard.sam.AddOrReplaceReadGroups INPUT=SRX020270.sorted.bam OUTPUT=SRX020270.resorted.bam SORT_ORDER=coordinate RGID=SRX020270 RGLB=bar RGPL=illumina RGPU=run barcode RGSM=SRX020270 CREATE_INDEX=true TMP_DIR=/tmp/ludongsheng VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_MD5_FILE=false
    INFO 2011-11-19 13:17:11 AddOrReplaceReadGroups Created read group ID=SRX020270 PL=illumina LB=bar SM=SRX020270

    [Sat Nov 19 13:18:34 CST 2011] net.sf.picard.sam.AddOrReplaceReadGroups done. Elapsed time: 1.39 minutes.
    Runtime.totalMemory()=5798559744
    Exception in thread "main" java.lang.RuntimeException: SAM validation error: ERROR: Record 8404072, Read name SRX020270.6546275, MAPQ should be 0 for unmapped read.
    at net.sf.samtools.SAMUtils.processValidationErrors(SAMUtils.java:334)
    at net.sf.samtools.BAMFileReader$BAMFileIterator.advance(BAMFileReader.java:469)
    at net.sf.samtools.BAMFileReader$BAMFileIterator.next(BAMFileReader.java:450)
    at net.sf.samtools.BAMFileReader$BAMFileIterator.next(BAMFileReader.java:417)
    at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:629)
    at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:607)
    at net.sf.picard.sam.AddOrReplaceReadGroups.doWork(AddOrReplaceReadGroups.java:91)
    at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:158)
    at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:118)
    at net.sf.picard.sam.AddOrReplaceReadGroups.main(AddOrReplaceReadGroups.java:61)

    I was told that read name SRX020270.6546275 was an unmapped read, so I checked out the entry for this read, and also the head line in SRX020270.sorted.bam.

    $ samtools view SRX020270.sorted.bam | grep "SRX020270.6546275"
    SRX020270.6546275 4 GL000198.1 90085 37 43M1D37M * 0 AGAATTCTTCAAAGAGTTCCAGATATCCACAGGCAGATTCTACAAATAAGTGTTTCAATACTGCTCTATCAAAAGACGTA BABA@?B?@BBBA@A@;?BBB@A<A?A@B@A>?AAA?>?@>@@?>A>@@@7@;;@?>@>@?:>A>@=<=@@=?@??>?;@ XT:A:U NM:i:4 X0:i:1 X1:i:0 XM:i:3 XO:i:1 XG:i:1 MD:Z:0C42^A3G29T3

    $ samtools view -H SRX020270.sorted.bam
    @SQ SN:1 LN:249250621
    @SQ SN:2 LN:243199373
    @SQ SN:3 LN:198022430
    @SQ SN:4 LN:191154276
    @SQ SN:5 LN:180915260
    @SQ SN:6 LN:171115067
    @SQ SN:7 LN:159138663
    @SQ SN:8 LN:146364022
    @SQ SN:9 LN:141213431
    @SQ SN:10 LN:135534747
    @SQ SN:11 LN:135006516
    @SQ SN:12 LN:133851895
    @SQ SN:13 LN:115169878
    @SQ SN:14 LN:107349540
    @SQ SN:15 LN:102531392
    @SQ SN:16 LN:90354753
    @SQ SN:17 LN:81195210
    @SQ SN:18 LN:78077248
    @SQ SN:19 LN:59128983
    @SQ SN:20 LN:63025520
    @SQ SN:21 LN:48129895
    @SQ SN:22 LN:51304566
    @SQ SN:X LN:155270560
    @SQ SN:Y LN:59373566
    @SQ SN:MT LN:16569
    @SQ SN:GL000207.1 LN:4262
    @SQ SN:GL000226.1 LN:15008
    @SQ SN:GL000229.1 LN:19913
    @SQ SN:GL000231.1 LN:27386
    @SQ SN:GL000210.1 LN:27682
    @SQ SN:GL000239.1 LN:33824
    @SQ SN:GL000235.1 LN:34474
    @SQ SN:GL000201.1 LN:36148
    @SQ SN:GL000247.1 LN:36422
    @SQ SN:GL000245.1 LN:36651
    @SQ SN:GL000197.1 LN:37175
    @SQ SN:GL000203.1 LN:37498
    @SQ SN:GL000246.1 LN:38154
    @SQ SN:GL000249.1 LN:38502
    @SQ SN:GL000196.1 LN:38914
    @SQ SN:GL000248.1 LN:39786
    @SQ SN:GL000244.1 LN:39929
    @SQ SN:GL000238.1 LN:39939
    @SQ SN:GL000202.1 LN:40103
    @SQ SN:GL000234.1 LN:40531
    @SQ SN:GL000232.1 LN:40652
    @SQ SN:GL000206.1 LN:41001
    @SQ SN:GL000240.1 LN:41933
    @SQ SN:GL000236.1 LN:41934
    @SQ SN:GL000241.1 LN:42152
    @SQ SN:GL000243.1 LN:43341
    @SQ SN:GL000242.1 LN:43523
    @SQ SN:GL000230.1 LN:43691
    @SQ SN:GL000237.1 LN:45867
    @SQ SN:GL000233.1 LN:45941
    @SQ SN:GL000204.1 LN:81310
    @SQ SN:GL000198.1 LN:90085
    @SQ SN:GL000208.1 LN:92689
    @SQ SN:GL000191.1 LN:106433
    @SQ SN:GL000227.1 LN:128374
    @SQ SN:GL000228.1 LN:129120
    @SQ SN:GL000214.1 LN:137718
    @SQ SN:GL000221.1 LN:155397
    @SQ SN:GL000209.1 LN:159169
    @SQ SN:GL000218.1 LN:161147
    @SQ SN:GL000220.1 LN:161802
    @SQ SN:GL000213.1 LN:164239
    @SQ SN:GL000211.1 LN:166566
    @SQ SN:GL000199.1 LN:169874
    @SQ SN:GL000217.1 LN:172149
    @SQ SN:GL000216.1 LN:172294
    @SQ SN:GL000215.1 LN:172545
    @SQ SN:GL000205.1 LN:174588
    @SQ SN:GL000219.1 LN:179198
    @SQ SN:GL000224.1 LN:179693
    @SQ SN:GL000223.1 LN:180455
    @SQ SN:GL000195.1 LN:182896
    @SQ SN:GL000212.1 LN:186858
    @SQ SN:GL000222.1 LN:186861
    @SQ SN:GL000200.1 LN:187035
    @SQ SN:GL000193.1 LN:189789
    @SQ SN:GL000194.1 LN:191469
    @SQ SN:GL000225.1 LN:211173
    @SQ SN:GL000192.1 LN:547496
    @PG ID:bwa PN:bwa VN:0.5.9-r16

    So, my question is, is there a way to fix this problem?
    Last edited by dongshenglulv; 11-18-2011, 10:44 PM.
  • swbarnes2
    Senior Member
    • May 2008
    • 910

    #2
    Add VALIDATION_STRINGENCY=LENIENT to your command line.

    This is a pretty minor problem. It's just like it says...you've got a read that's flagged as unmapped, yet has a mapping quality. This is technically allowable in the .sam format, but Picard is being strict by default and refusing to handle it. bwa, for instance, will output reads like this, because it concatenates reference sequences together, and when a read hangs off of one sequence and on to another, bwa will mark it as mapped, but will also throw the unampped flag in there as a sign that something is a bit off.

    So change the strictness and you'll be fine. On lenient, it'll output all the read names that it has problems with.

    Comment

    • dongshenglulv
      Member
      • May 2011
      • 15

      #3
      Thanks very much, I've already done by what you've suggested.

      Comment

      • bwubb
        Member
        • Jan 2012
        • 61

        #4
        Ok so this use to not be a problem for me. VALIDATION_STRINGENCY=LENIENT ( OR SILENT) use to work.

        Recently though, perhaps since upgrading to picard tools 1.94 I have not been able to get passed this error.

        It happens at the end of AddOrReplaceReadGroups

        Code:
        ...
        INFO	2013-07-05 16:34:17	AddOrReplaceReadGroups	Processed    20,000,000 records.  Elapsed time: 00:06:16s.  Time for last 1,000,000:   18s.  Last read position: X:71,599,822
        [Fri Jul 05 16:34:33 EDT 2013] net.sf.picard.sam.AddOrReplaceReadGroups done. Elapsed time: 6.55 minutes.
        Runtime.totalMemory()=2851209216
        To get help, see http://picard.sourceforge.net/index.shtml#GettingHelp
        Exception in thread "main" net.sf.samtools.SAMFormatException: SAM validation error: ERROR: Record 20570683, Read name HWI-ST965:305:C0MR9ACXX:7:2212:16408:51025, MAPQ should be 0 for unmapped read.
        	at net.sf.samtools.SAMUtils.processValidationErrors(SAMUtils.java:448)
        	at net.sf.samtools.BAMFileReader$BAMFileIterator.advance(BAMFileReader.java:541)
        	at net.sf.samtools.BAMFileReader$BAMFileIterator.next(BAMFileReader.java:522)
        	at net.sf.samtools.BAMFileReader$BAMFileIterator.next(BAMFileReader.java:481)
        	at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:672)
        	at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:650)
        	at net.sf.picard.sam.AddOrReplaceReadGroups.doWork(AddOrReplaceReadGroups.java:98)
        	at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:177)
        	at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:119)
        	at net.sf.picard.sam.AddOrReplaceReadGroups.main(AddOrReplaceReadGroups.java:66)
        Is anyone else running into this issue again? Im trying to use CleamSam first right now, but that has never seemed to work for anyone ever, as far as I can tell.

        Comment

        Latest Articles

        Collapse

        • SEQadmin2
          Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
          by SEQadmin2



          CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

          Despite this, “CRISPR helped turn genome editing from a specialized technique into
          ...
          07-31-2026, 11:01 AM
        • SEQadmin2
          Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
          by SEQadmin2


          Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

          The systematic characterization of the human proteome has
          ...
          07-20-2026, 11:48 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by SEQadmin2, 08-13-2026, 12:22 PM
        0 responses
        23 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 08-11-2026, 10:35 AM
        0 responses
        19 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 08-06-2026, 07:41 AM
        0 responses
        33 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 08-03-2026, 10:13 AM
        0 responses
        51 views
        0 reactions
        Last Post SEQadmin2  
        Working...