[dawe]

Yes, parameters and/or working principles are poorly documented. I agree, it is really fast.
Are you using fastq-mcf in production?

I'm using fastq-join and fastq-mcf. The first for overlapping paired end reads, the second to de-multiplex NuGEN RNA-seq libraries.
I'm trying to get some more doc (the developer is very active...)

[sklages]

ea-utils is really fast, unfortunately lacks proper documentation

Yes, parameters and/or working principles are poorly documented. I agree, it is really fast.
Are you using fastq-mcf in production?

[dawe]

ea-utils is really fast, unfortunately lacks proper documentation

[sklages]

I have moved to trimmomatic - it does SE and PE as well and in my hands much much faster.

FAR does SE/PE as well (starting from version 2 AFAIK).
Speed is not really a matter for me. If it takes five minutes per lane, fine, if it takes one hour, fine too (considering instrument run time and time for downstream analysis) :-)

Have you compared the results? Similar?

[kga1978]

I have moved to trimmomatic - it does SE and PE as well and in my hands much much faster.

[sklages]

@All,
are you happy with FAR or are you using other tools for (illumina) adpator/quality clipping?
I am trying to figure out which is the "best" one, in terms of flexibility and good results.

Currently I am playing around with far (surely developed for Mac as the Makefile needs to be fixed for compiling on linux). It seems quite flexible, "verbose" and it works on PE data directly.

Sven

[ETHANol]

Okay, I'm stupid. Little mistake in my adapter file. Thanks for the code Joseph!! It showed me where to look.

[joseph]

Hi Ethan
it worked fine for me

 far --source myfile.fastq --target myoutput.fastq --format fastq --adapters adapters.fasta --nr-threads 4 

far --source SRR309288.fastq --target SRR309288_far_trim --format fastq --adapters adapter.fa --nr-threads 2 
source file was set to SRR309288.fastq.
No 2nd input file specified! (Run is not paired)
target file was set to SRR309288_far_trim.
File format was set to FASTQ-illumina15
Will do demultiplexing and adapter removal... 
Adapter file: adapter.fa
Nr. of allowed indels + mismatches per 10 bases: 2
Allowed number of uncalled bases was set to 0
Chosen scoring scheme: match = 3 ,mismatch = -3 ,gap opening = -20
Trimming from right end. 
Minimum required overlap: 10
Overlap will be treated as standard overlap. 
Adapter sequences are:
adapter
TCGTATGCCGTCTTCTGCTTGT
No barcodes file specified... 
Minimum required readlength: 18
Using 2 threads.
Writing omitted read ids to: SRR309288.fastq.omitted
Using no phred-quality trimming.
Starting processing (algorithm: needleman-wunsch)...
Done.
Calculation Time: 28 minutes 53 seconds. 
Step 1 - filtering input files: 
=============================== 
Input file contained 13823407 reads.
Discarded in total 309069 reads due to containing uncalled bases.
Discarded in total 0 reads due to having low quality.
Used      13823407 reads from input file.
12037203 reads remaining ( 85.1741 % of input reads )
Statistics on each output file:
===============================
File: SRR309288_far_trim.fastq
Nr. of reads dropped due to being shorter than minLength: 1477135
Nr. of reads written to the file: 12037203
Writing length distributions of reads (for each file) 
Statistics on adapter removal (input files):
============================================
Adapter	removal_count
adapter	10847050
Min-/Max-/Mean-/Median-overlap length: 10 / 23 / 12 / 11

these are the files:

> head -20 SRR309288.fastq
@SRR309288.1 ILLUMINA-432AEC_0016:4:1:959:1667 length=36
NNNNNNNNCNNNNTNATGTTGACATCTCGTATGCCG
+SRR309288.1 ILLUMINA-432AEC_0016:4:1:959:1667 length=36
####################################
@SRR309288.2 ILLUMINA-432AEC_0016:4:1:959:8156 length=36
NNNNNNNNCNNNNNNTATGCCGTCTTCGGCTTGCAA
+SRR309288.2 ILLUMINA-432AEC_0016:4:1:959:8156 length=36
####################################
@SRR309288.3 ILLUMINA-432AEC_0016:4:1:959:1631 length=36
NNNNNNNNCNNNNTNATGTTGACATCTCGTATGCCG
+SRR309288.3 ILLUMINA-432AEC_0016:4:1:959:1631 length=36
####################################
@SRR309288.4 ILLUMINA-432AEC_0016:4:1:960:2745 length=36
NNNNNNNNCNNANANCATCTCGTATGCCGTCTTCTG
+SRR309288.4 ILLUMINA-432AEC_0016:4:1:960:2745 length=36
########(##'#1#4366.???>><>?>???>?>7
@SRR309288.5 ILLUMINA-432AEC_0016:4:1:960:1472 length=36
NNNNNNNNTNNANTNAGAAGGCATCTCGTATGCCGT
+SRR309288.5 ILLUMINA-432AEC_0016:4:1:960:1472 length=36
####################################


> head -20 SRR309288_far_trim
head: SRR309288_far_trim: No such file or directory
boyce-162-119:FAR jdhahbi$ head -20 SRR309288_far_trim.fastq
@SRR309288.531 ILLUMINA-432AEC_0016:4:1:1019:15214 length=36
CACCCGTAGAACCGACCTTGCATC
+
GFEGGFFAFDAECDCFFFDFEEGE
@SRR309288.532 ILLUMINA-432AEC_0016:4:1:1019:12253 length=36
CTGAGCCGAGAATGGGGATC
+
FF5FFFDFEDBADDD-DCAD
@SRR309288.533 ILLUMINA-432AEC_0016:4:1:1019:9688 length=36
GCATTGTGGTTCAGTGGTAGAATTCTCGATCTCGTA
+
:E?EEAEEEEBE?D?EEA?ED=DEE5EE-:DD-DDA
@SRR309288.534 ILLUMINA-432AEC_0016:4:1:1019:6554 length=36
TAGCTTATCAGACTGATGTTGACATC
+
FGGGGGGFGDEGGGGGGGGGFGGGGG
@SRR309288.535 ILLUMINA-432AEC_0016:4:1:1019:15771 length=36
TAGCTTATCAGACTGATGTTGACATC
+
GFGFFFA?DFE-BEDBFDFFF?F:EF

[ETHANol]

I tried to install dawe's precompiled binary (Thanks for sharing!!!). It is for OSX correct?
I ran:

sudo tar xvzf far.tgz -C /usr/local

Then I made a couple short test files if fasta format because it is the most simple.

And this is what I get:

$ far -s fartest.fasta -t fartestout.fa -f fasta -a IlluminaAdapters.fa
source file was set to fartest.fasta.
No 2nd input file specified! (Run is not paired)

target file was set to fartestout.fa.
File format was set to FASTA
Will do demultiplexing and adapter removal... 
Adapter file: IlluminaAdapters.fa

Nr. of allowed indels + mismatches per 10 bases: 2

Allowed number of uncalled bases was set to 0
Chosen scoring scheme: match = 3 ,mismatch = -3 ,gap opening = -20
Trimming from right end. 
Minimum required overlap: 10
Overlap will be treated as standard overlap. 
Segmentation fault

Not sure what a segmentation fault is, but could it be that the precompiled binary dawe posted isn't exactly right for my computer?

[joseph]

You can download it here. Uncompress in /usr/local:

sudo tar xvzf far.tgz -C /usr/local

it should be working.

d

It works. Thank you.

[dawe]

AFAIK it doesn't understand gzipped fastq. You should try with a subshell, i.e.

far -s <(zcat G676_subsampled.fastq.gz) -f fastq -o 6 -th 6 -a contaminants.fasta -t stdout

[kga1978]

Hey dawe,

Thanks for uploading the binary - very helpful!

[dawe]

yes, please send me a precompiled binary.
Thank you.
Joseph

You can download it here. Uncompress in /usr/local:

sudo tar xvzf far.tgz -C /usr/local

it should be working.

d

[joseph]

BTW, build from source works. If you need a precompiled binary I can provide one.

yes, please send me a precompiled binary.
Thank you.
Joseph

[dawe]

BTW, build from source works. If you need a precompiled binary I can provide one.