Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
Originally posted by ECO View PostMaybe report what errors you encountered...?
MacOSX: Copy the libtbb.dylib from ./lib into your lib searchpath.
I copied ibtbb.dylib to /usr/local/bin
but I am not able to figure out from the instructions what are the next steps after copying this file to /usr/local/bin.
I tried to run it:
far --adapters adapters.fasta --source test.fa --target test_result.fa --format fasta --log-level ALL --cut-off 4 --min-overlap 6
-bash: far: command not found
thanks
Comment
-
Originally posted by ECO View PostI can't get it to run either. Seems there are either files missing and/or it's not compiled correctly for OSX...shame, seems like a cool utility!
Code:$ otool -L libtbb.dylib
Code:$ install_name_tool -id /usr/local/lib/libtbb.dylib libtbb.dylib
Code:$ install_name_tool -change /path/to/libtbb.dylib /usr/local/lib/libtbb.dylib far
@joseph: your far installation should be in a directory in the PATH env variable :-)
Comment
-
I tried to install dawe's precompiled binary (Thanks for sharing!!!). It is for OSX correct?
I ran:
Code:sudo tar xvzf far.tgz -C /usr/local
And this is what I get:
Code:$ far -s fartest.fasta -t fartestout.fa -f fasta -a IlluminaAdapters.fa source file was set to fartest.fasta. No 2nd input file specified! (Run is not paired) target file was set to fartestout.fa. File format was set to FASTA Will do demultiplexing and adapter removal... Adapter file: IlluminaAdapters.fa Nr. of allowed indels + mismatches per 10 bases: 2 Allowed number of uncalled bases was set to 0 Chosen scoring scheme: match = 3 ,mismatch = -3 ,gap opening = -20 Trimming from right end. Minimum required overlap: 10 Overlap will be treated as standard overlap. Segmentation fault
--------------
Ethan
Comment
-
Hi Ethan
it worked fine for me
Code:far --source myfile.fastq --target myoutput.fastq --format fastq --adapters adapters.fasta --nr-threads 4 far --source SRR309288.fastq --target SRR309288_far_trim --format fastq --adapters adapter.fa --nr-threads 2 source file was set to SRR309288.fastq. No 2nd input file specified! (Run is not paired) target file was set to SRR309288_far_trim. File format was set to FASTQ-illumina15 Will do demultiplexing and adapter removal... Adapter file: adapter.fa Nr. of allowed indels + mismatches per 10 bases: 2 Allowed number of uncalled bases was set to 0 Chosen scoring scheme: match = 3 ,mismatch = -3 ,gap opening = -20 Trimming from right end. Minimum required overlap: 10 Overlap will be treated as standard overlap. Adapter sequences are: adapter TCGTATGCCGTCTTCTGCTTGT No barcodes file specified... Minimum required readlength: 18 Using 2 threads. Writing omitted read ids to: SRR309288.fastq.omitted Using no phred-quality trimming. Starting processing (algorithm: needleman-wunsch)... Done. Calculation Time: 28 minutes 53 seconds. Step 1 - filtering input files: =============================== Input file contained 13823407 reads. Discarded in total 309069 reads due to containing uncalled bases. Discarded in total 0 reads due to having low quality. Used 13823407 reads from input file. 12037203 reads remaining ( 85.1741 % of input reads ) Statistics on each output file: =============================== File: SRR309288_far_trim.fastq Nr. of reads dropped due to being shorter than minLength: 1477135 Nr. of reads written to the file: 12037203 Writing length distributions of reads (for each file) Statistics on adapter removal (input files): ============================================ Adapter removal_count adapter 10847050 Min-/Max-/Mean-/Median-overlap length: 10 / 23 / 12 / 11
Code:> head -20 SRR309288.fastq @SRR309288.1 ILLUMINA-432AEC_0016:4:1:959:1667 length=36 NNNNNNNNCNNNNTNATGTTGACATCTCGTATGCCG +SRR309288.1 ILLUMINA-432AEC_0016:4:1:959:1667 length=36 #################################### @SRR309288.2 ILLUMINA-432AEC_0016:4:1:959:8156 length=36 NNNNNNNNCNNNNNNTATGCCGTCTTCGGCTTGCAA +SRR309288.2 ILLUMINA-432AEC_0016:4:1:959:8156 length=36 #################################### @SRR309288.3 ILLUMINA-432AEC_0016:4:1:959:1631 length=36 NNNNNNNNCNNNNTNATGTTGACATCTCGTATGCCG +SRR309288.3 ILLUMINA-432AEC_0016:4:1:959:1631 length=36 #################################### @SRR309288.4 ILLUMINA-432AEC_0016:4:1:960:2745 length=36 NNNNNNNNCNNANANCATCTCGTATGCCGTCTTCTG +SRR309288.4 ILLUMINA-432AEC_0016:4:1:960:2745 length=36 ########(##'#1#4366.???>><>?>???>?>7 @SRR309288.5 ILLUMINA-432AEC_0016:4:1:960:1472 length=36 NNNNNNNNTNNANTNAGAAGGCATCTCGTATGCCGT +SRR309288.5 ILLUMINA-432AEC_0016:4:1:960:1472 length=36 #################################### > head -20 SRR309288_far_trim head: SRR309288_far_trim: No such file or directory boyce-162-119:FAR jdhahbi$ head -20 SRR309288_far_trim.fastq @SRR309288.531 ILLUMINA-432AEC_0016:4:1:1019:15214 length=36 CACCCGTAGAACCGACCTTGCATC + GFEGGFFAFDAECDCFFFDFEEGE @SRR309288.532 ILLUMINA-432AEC_0016:4:1:1019:12253 length=36 CTGAGCCGAGAATGGGGATC + FF5FFFDFEDBADDD-DCAD @SRR309288.533 ILLUMINA-432AEC_0016:4:1:1019:9688 length=36 GCATTGTGGTTCAGTGGTAGAATTCTCGATCTCGTA + :E?EEAEEEEBE?D?EEA?ED=DEE5EE-:DD-DDA @SRR309288.534 ILLUMINA-432AEC_0016:4:1:1019:6554 length=36 TAGCTTATCAGACTGATGTTGACATC + FGGGGGGFGDEGGGGGGGGGFGGGGG @SRR309288.535 ILLUMINA-432AEC_0016:4:1:1019:15771 length=36 TAGCTTATCAGACTGATGTTGACATC + GFGFFFA?DFE-BEDBFDFFF?F:EF
Comment
-
@All,
are you happy with FAR or are you using other tools for (illumina) adpator/quality clipping?
I am trying to figure out which is the "best" one, in terms of flexibility and good results.
Currently I am playing around with far (surely developed for Mac as the Makefile needs to be fixed for compiling on linux). It seems quite flexible, "verbose" and it works on PE data directly.
Sven
Comment
Latest Articles
Collapse
-
by seqadmin
Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...-
Channel: Articles
04-04-2024, 04:25 PM -
-
by seqadmin
Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...-
Channel: Articles
03-22-2024, 06:39 AM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, 04-11-2024, 12:08 PM
|
0 responses
25 views
0 likes
|
Last Post
by seqadmin
04-11-2024, 12:08 PM
|
||
Started by seqadmin, 04-10-2024, 10:19 PM
|
0 responses
28 views
0 likes
|
Last Post
by seqadmin
04-10-2024, 10:19 PM
|
||
Started by seqadmin, 04-10-2024, 09:21 AM
|
0 responses
24 views
0 likes
|
Last Post
by seqadmin
04-10-2024, 09:21 AM
|
||
Started by seqadmin, 04-04-2024, 09:00 AM
|
0 responses
52 views
0 likes
|
Last Post
by seqadmin
04-04-2024, 09:00 AM
|
Comment