Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • dandyrilla
    Junior Member
    • Aug 2011
    • 2

    #1

    BWA produces odd alignment results

    I tried to get a uniquely mapped reads from BWA alignment, so I filtering out the alignments without XT:A:U in SAM line.

    However, BWA produces odd aligned reads, which is both unmapped and uniquely mapped.

    These reads below have both SAM flag which means 'reads unmapped' and mapping position.(chrom, pos)

    How can that be? Have you ever gotten such reads?

    SRR101341.21640516 4 chr3 199501827 0 33M * 0 0 GACCCTAACCCTAACCCTAACCCTAACCCTAAC 0)@@)?''0-68?09384;<5=)A;56@>167: XT:A:U NM:i:0 XN:i:1 X0:i:1 X1:i:557 XM:i:0 XO:i:0 XG:i:0 MD:Z:33

    SRR101344.29575296 133 chr11 134452345 15 43M chr12 92723370 0 TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGAGG CCCCCCCCCCCCCCCCCCDCCCCCDCCCCCBB@CCCBCCCC@C XT:A:U NM:i:0 XN:i:3 SM:i:15 AM:i:0 X0:i:1 X1:i:6 XM:i:0 XO:i:0 XG:i:0 MD:Z:43 XA:Z:chr3,+199385175,43M,1;chrX,+154913557,43M,1;chrY,+57772757,43M,1;chr11,+134452000,43M,1;chr1,-397,43M,1;chr18,-25,43M,1;

    thanks (^______^)
    Last edited by dandyrilla; 11-27-2011, 09:48 PM.
  • swbarnes2
    Senior Member
    • May 2008
    • 910

    #2
    bwa concatenates reference sequences together, and if a read hangs off of one reference, and onto another, bwa will both give it a mapping position, and a 4 flag.

    More commonly, sam specs call for the unmapped read of a pair to be given the mapping position of its mapped mate, and the 4 flag.

    But from your coordinates, I'm betting that the first is the answer.

    Comment

    • dandyrilla
      Junior Member
      • Aug 2011
      • 2

      #3
      Why 'XT:A:U' is in the unmapped line?

      Thanks, swbarnes2!

      And then,
      why 'XT:A:U' is in the unmapped line?

      I know that 'XT:A:U' means uniquely mapped read.
      Is it right?
      What does it mean?

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
        by SEQadmin2


        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

        The systematic characterization of the human proteome has
        ...
        07-20-2026, 11:48 AM
      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, Today, 02:55 AM
      0 responses
      1 view
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-24-2026, 12:17 PM
      0 responses
      10 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-23-2026, 11:41 AM
      0 responses
      11 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-20-2026, 11:10 AM
      0 responses
      23 views
      0 reactions
      Last Post SEQadmin2  
      Working...