Tweet
When I run the software, it returns an error.
you can see it in the attachment, please give me some suggestion.
thank you very much.
you can see it in the attachment, please give me some suggestion.
thank you very much.
-
-
As the error states, "Sequence must start with @: >@ ..." Meaning that Picard is trying to read the sequence and is failing. It calls the method FastqToSam but the file you gave it is in fasta format. You need to convert it beforehand (remove the '>' at the beginning of lines) -
I open and detect my data file, But i don't find ">".
This is a sequence in my data file.
@HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:
TGCAGAACAAGGTTTTTGCCTCATTTTGAAAGGAGAAAATCAATTTAAGTTGCTGCTTCAATGCCAGATCAAGGGTCTCCAAAGAGCACAGCAGA
+
FFFHHHHHJJJJIIJJJIJJJJIJJJJJHIIJJJJFGIJJJGIJJJJIJGIJJJIJJJGGIEEHJEGIGFEHDFFEFEEEEDECDDDDDDDDDD<Comment
-
I open and detect my data file, But i don't find ">".
This is a sequence in my data file.
@HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:
TGCAGAACAAGGTTTTTGCCTCATTTTGAAAGGAGAAAATCAATTTAAGTTGCTGCTTCAATGCCAGATCAAGGGTCTCCAAAGAGCACAGCAGA
+
FFFHHHHHJJJJIIJJJIJJJJIJJJJJHIIJJJJFGIJJJGIJJJJIJGIJJJIJJJGGIEEHJEGIGFEHDFFEFEEEEDECDDDDDDDDDD<Comment
-
I opened and detected my data file, But i didn't find ">".
This is a sequence in my data file.
@HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:
TGCAGAACAAGGTTTTTGCCTCATTTTGAAAGGAGAAAATCAATTTAAGTTGCTGCTTCAATGCCAGATCAAGGGTCTCCAAAGAGCACAGCAGA
+
FFFHHHHHJJJJIIJJJIJJJJIJJJJJHIIJJJJFGIJJJGIJJJJIJGIJJJIJJJGGIEEHJEGIGFEHDFFEFEEEEDECDDDDDDDDDD<Comment
-
would you try plat text file , not the gz file?Comment
-
It's OK. Thanks a lot.Comment
-
If I run Estimatelibrarycomplexity.jar, it seems that the data format is wrong again.
ERROR: Error parsing SAM header. Unrecognized header record type. Line: @HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:Comment
-
how do you solved your hard problem?Comment
-
Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.
The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
...06-02-2026, 10:05 AM -
With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.
Introduction
Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...05-22-2026, 06:42 AM
Comment