Tweet
When I run the software, it returns an error.
you can see it in the attachment, please give me some suggestion.
thank you very much.
you can see it in the attachment, please give me some suggestion.
thank you very much.
-
-
As the error states, "Sequence must start with @: >@ ..." Meaning that Picard is trying to read the sequence and is failing. It calls the method FastqToSam but the file you gave it is in fasta format. You need to convert it beforehand (remove the '>' at the beginning of lines) -
I open and detect my data file, But i don't find ">".
This is a sequence in my data file.
@HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:
TGCAGAACAAGGTTTTTGCCTCATTTTGAAAGGAGAAAATCAATTTAAGTTGCTGCTTCAATGCCAGATCAAGGGTCTCCAAAGAGCACAGCAGA
+
FFFHHHHHJJJJIIJJJIJJJJIJJJJJHIIJJJJFGIJJJGIJJJJIJGIJJJIJJJGGIEEHJEGIGFEHDFFEFEEEEDECDDDDDDDDDD<Comment
-
I open and detect my data file, But i don't find ">".
This is a sequence in my data file.
@HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:
TGCAGAACAAGGTTTTTGCCTCATTTTGAAAGGAGAAAATCAATTTAAGTTGCTGCTTCAATGCCAGATCAAGGGTCTCCAAAGAGCACAGCAGA
+
FFFHHHHHJJJJIIJJJIJJJJIJJJJJHIIJJJJFGIJJJGIJJJJIJGIJJJIJJJGGIEEHJEGIGFEHDFFEFEEEEDECDDDDDDDDDD<Comment
-
I opened and detected my data file, But i didn't find ">".
This is a sequence in my data file.
@HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:
TGCAGAACAAGGTTTTTGCCTCATTTTGAAAGGAGAAAATCAATTTAAGTTGCTGCTTCAATGCCAGATCAAGGGTCTCCAAAGAGCACAGCAGA
+
FFFHHHHHJJJJIIJJJIJJJJIJJJJJHIIJJJJFGIJJJGIJJJJIJGIJJJIJJJGGIEEHJEGIGFEHDFFEFEEEEDECDDDDDDDDDD<Comment
-
would you try plat text file , not the gz file?Comment
-
It's OK. Thanks a lot.Comment
-
If I run Estimatelibrarycomplexity.jar, it seems that the data format is wrong again.
ERROR: Error parsing SAM header. Unrecognized header record type. Line: @HWI-ST298:282:C05BGACXX:4:1101:6099:2249 1:N:0:Comment
-
how do you solved your hard problem?Comment
-
Innovations in next-generation sequencing technologies and techniques are driving more precise and comprehensive exploration of complex biological systems. Current advancements include improved accessibility for long-read sequencing and significant progress in single-cell and 3D genomics. This article explores some of the most impactful developments in the field over the past year.
Long-Read Sequencing
Long-read sequencing has seen remarkable advancements,...12-02-2024, 01:49 PM
Comment