Conversion from ‘qseq.txt’ to ‘fastq’ format

[joseph]

Hi
Can anybody suggest a program or share a code to convert the illumina _qseq.txt files to fastq format used as input for Bowtie?
Thanks,
Joseph

[kmcarr]

Here is some perl code which does the bare minimum to convert qseq to fastq

(name the script qseq2fastq.pl)

#!/usr/bin/perl

use warnings;
use strict;

while (<>) {
	chomp;
	my @parts = split /\t/;
	print "@","$parts[0]:$parts[2]:$parts[3]:$parts[4]:$parts[5]#$parts[6]/$parts[7]\n";
	print "$parts[8]\n";
	print "+\n";
	print "$parts[9]\n";
}

To use this code (assuming you are using pipline 1.3.2) cd to your GERALD directory and type the following:

cat Temp/s_1_1_0???_ub_qseq.txt | qseq2fastq.pl > s_1_1.fastq

This will collect all of the files for lane 1, read 1 in the GERALD/Temp directory and output a single fastq for lane1, read 1.

I use the qseq files in the GERALD/Temp directory instead of the Bustard directory because of the difference in the way these files represent positions with no base call or an ambiguous base call. The files in the Bustard directory have a '.' in the sequence string while those in the Gerald/Temp directory have an 'N'. If you want to use the qseq files in the Bustard directory you will have to add some code to change any '.'s in the sequence line to 'N's.

The quality scores are still represented as Illumina's phred64 so don't forget to either convert prior to running bowtie or pass the --phred64 option when running bowtie.

[joseph]

trying qseq2fastq.pl

Hi
Thank you for your help.
To try your script, I copied 4 files to a dir along with qseq2fastq.pl.
Here is the content of the dir:
ls
qseq2fastq.pl s_7_1_0001_ub_qseq.txt s_7_1_0002_ub_qseq.txt s_7_1_0003_ub_qseq.txt s_7_1_0004_ub_qseq.txt

I got an error:
cat s_7_1_0???_ub_qseq.txt | qseq2fastq.pl > s_7_1.fastq
-bash: qseq2fastq.pl: command not found

When I added perl to the command, I did not get the error but the output file s_7_1.fastq was empty:

cat s_7_1_0???_ub_qseq.txt | perl qseq2fastq.pl > s_7_1.fastq

any suggestions?
Thanks,
Joseph

[joseph]

please ignore

Hi
Thank you for your help.
To try your script, I copied 4 files to a dir along with qseq2fastq.pl.
Here is the content of the dir:
ls
qseq2fastq.pl s_7_1_0001_ub_qseq.txt s_7_1_0002_ub_qseq.txt s_7_1_0003_ub_qseq.txt s_7_1_0004_ub_qseq.txt

I got an error:
cat s_7_1_0???_ub_qseq.txt | qseq2fastq.pl > s_7_1.fastq
-bash: qseq2fastq.pl: command not found

When I added perl to the command, I did not get the error but the output file s_7_1.fastq was empty:

cat s_7_1_0???_ub_qseq.txt | perl qseq2fastq.pl > s_7_1.fastq

any suggestions?
Thanks,
Joseph

please ignore the above message. I got it to work. Thanks

[Alvaro Hernandez]

Need help on this topic

I need to get this script to work with the qseq.txt files in GERALD from pipeline 1.5 Could someone modify it so that it works?. There may be a difference with the qseq.txt files from previous pipelines because the script throws a lot of error messages like this:

mymac:fasta programmer$ perl s_1_1_0???_ub_qseq.txt | qseq2fastq.pl > s_1_1.fastq
-bash: qseq2fastq.pl: command not found
Number found where operator expected at s_1_1_0001_ub_qseq.txt line 1, near "1 1"
(Missing operator before 1?)
Number found where operator expected at s_1_1_0001_ub_qseq.txt line 1, near "1 1"
(Missing operator before 1?)
Number found where operator expected at s_1_1_0001_ub_qseq.txt line 1, near "1 0"
(Missing operator before 0?)
Number found where operator expected at s_1_1_0001_ub_qseq.txt line 1, near "0 24"
(Missing operator before 24?)
Number found where operator expected at s_1_1_0001_ub_qseq.txt line 1, near "240"
(Missing operator before 0?)
Number found where operator expected at s_1_1_0001_ub_qseq.txt line 1, near "0 1"


This will be highly appreciated!!

[Xi Wang]

mymac:fasta programmer$ perl s_1_1_0???_ub_qseq.txt | qseq2fastq.pl > s_1_1.fastq
-bash: qseq2fastq.pl: command not found
Number found where operator expected at s_1_1_0001_ub_qseq.txt line 1, near "1 1"
(Missing operator before 1?)
Number found where operator expected at s_1_1_0001_ub_qseq.txt line 1, near "1 1"
(Missing operator before 1?)
Number found where operator expected at s_1_1_0001_ub_qseq.txt line 1, near "1 0"
(Missing operator before 0?)
Number found where operator expected at s_1_1_0001_ub_qseq.txt line 1, near "0 24"
(Missing operator before 24?)
Number found where operator expected at s_1_1_0001_ub_qseq.txt line 1, near "240"
(Missing operator before 0?)
Number found where operator expected at s_1_1_0001_ub_qseq.txt line 1, near "0 1"


This will be highly appreciated!!

Your command should be written as:

cat s_1_1_0???_ub_qseq.txt | perl qseq2fastq.pl > s_1_1.fastq

[Alvaro Hernandez]

one more question

Xi Wang,

Thank you for your help, it now worked!

One more question: The fastq file from GERALD has the following structure for each read:

@HWI-EAS385_0042:7:1:54:1892#0/1
TAGCTCTTGATCCGGCAAACAAACCAACGCTTGGAGCGGGGGGGGGACGGGAGAGGGGGTCAGCCGGAGGGCGGGGACCA
+HWI-EAS385_0042:7:1:54:1892#0/1
`baabaaaaa`][aaaa_a^^aaaa^`a``\[]`UXQVW^_\MFX^[ZMDT\\^WFX_^XXK[TH^YIS\XYONVYQY^[

(this is: @read name, another line with the read sequence, another line with +read name and another line with quality scores)

However, this script gives the following structure:

@HWUSI-EAS594-R:1:3:1453:1350#0/1
CCCAGTTCCGACGATCGATTTGCACGTCAGAATCGCTACGGACCTCCATCAGGGTTTCCCCTGACTTCGTCCTGACCAGG
+
eea^cdfdffgggggggggggeggggdggdffgdbdgddgggg`g^dfbfgdggcfbgfffcb]gffbfcfcefbbBBBB

(does not give the read name after the +). Will it recognize that the quality scores belong to that read? How can I make the read name appear after the + to make it exactly similar to the GERALD file?

Thanks again for your expert help!

Alvaro

[Xi Wang]

How can I make the read name appear after the

You can use the script below (name it qseq2fastq.pl and replace the former one):

#!/usr/bin/perl

use warnings;
use strict;

while (<>) {
	chomp;
	my @parts = split /\t/;
	print "@","$parts[0]:$parts[2]:$parts[3]:$parts[4]:$parts[5]#$parts[6]/$parts[7]\n";
	print "$parts[8]\n";
	print "+","$parts[0]:$parts[2]:$parts[3]:$parts[4]:$parts[5]#$parts[6]/$parts[7]\n";
	print "$parts[9]\n";
}

[Alvaro Hernandez]

***Thanks!!

Xi Wang,

Your modified script run perfectly. Thanks again for sharing your expertise and following up with this. You saved my day.

AH

[kmcarr]

(does not give the read name after the +). Will it recognize that the quality scores belong to that read? How can I make the read name appear after the + to make it exactly similar to the GERALD file?
Alvaro

The official definition of the FASTQ format (see here and here) states that the name following the '+' is optional. Including exactly the same information twice is inefficient. Any software which reads FASTQ files should follow the standard and not require the name after the +.

[Alvaro Hernandez]

Thanks

Thanks kmcarr, it is good to know that. I usually just deal with the standard pipeline but this time GERALD could not finish the alignment and had to merge these files, so I am learning all these things.

And the original script was yours so I appreciate you sharing it with everybody and Xi Wang for showing me how to use it.

[genbio64]

A quick and easy way is to convert it using CLC Genomeworkbench.

[extrajos]

qseq vs. illumina-fastq

Hi All,

I am wondering if qseq format is the same thing as fastq-illumina (differing from fastq-sanger only in the calculation of the quality score) or if qseq and fastq-illumina are different formats.

Thanks!

[Thomas Doktor]

They are the same format, the qseq files are simply tile-divided sequence files. <- Not correct! See kmcarr's response below.

Following in the footsteps of perl - there is always more than one way to do it - did you (Alvaro) try configuring GERALD to just output the sequences instead of aligning them?
It can be done in the config file for the GERALD script by simply telling GERALD to output the sequence from the given lanes, e.g.:
123:ANALYSIS sequence

genbio64, only if you have the money for CLC

[drio]

Hi
Can anybody suggest a program or share a code to convert the illumina _qseq.txt files to fastq format used as input for Bowtie?
Thanks,
Joseph

Most aligners come with scripts to perform those conversions. bfast has (scripts/ill2fastq.pl).