Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • kga1978
    Senior Member
    • Nov 2010
    • 100

    Subsampling using 'head -n #"?

    Hi all,

    I often subsample my fastq files by using the unix 'head' command, rather than randomly getting reads from random positions in my fastq file. My setup is as follows:

    Casava output
    Code:
    file1.fastq.gz
    file2.fastq.gz
    .
    .
    file#.fastq.gz
    I concatenate these files using the following:

    Code:
    gunzip *.gz -c | gzip -9 > file.fastq.gz
    In this way, the first part of this file will contain the reads from the original 'file1.fastq.gz'. I then subsample 25.000 reads from this file using the following command:

    Code:
    head -n 100000 file.fastq.gz | <downstream analysis, e.g. blastn>
    My worry is that by doing that, I will get some sort of bias in my analysis as I am only taking the 'head' of the first part of all my reads. The question is - is this a valid concern? I.e. are the reads in the first part of, say, 'file1.fastq.gz' somehow different than, say, the middle part of 'file4.fastq.gz'?

    Thanks very much in advance
  • jbrwn
    Member
    • Mar 2011
    • 37

    #2
    it's definitely not very rigorous. htseq has a fastq reader in it which could help you subsample randomly.
    htseq tour
    previous discussion on subsampling paired-end data:

    Comment

    • gringer
      David Eccles (gringer)
      • May 2011
      • 845

      #3
      I do this often (mostly to make sure that the output data format is correct) and often find that it's a really bad representation of the data due to strange biases, low mapping quality, and odd mappings with unequal distribution to name a few. SOLiD or Illumina output files have a pile of rubbish at the start of the file from bad sequencing reads (the edges of chips / cells seem to be more prone to error), which heavily influences the results gleaned from the first few reads.

      If you've been already doing this, I'm somewhat surprised you haven't discovered this already.

      If you can afford the time and want something more representative but keeping within quick command-line stuff, use 'shuf -n' instead of 'head -n'. You could also try dumping the first million or so reads (or more), then take the next million or so (but there'll still be some bias there as well).
      Last edited by gringer; 12-28-2011, 11:18 AM.

      Comment

      • kga1978
        Senior Member
        • Nov 2010
        • 100

        #4
        Thanks for the replies - that's very helpful.

        I have only been running this over the last couple of days (but we have loads where I need to do it) and didn't notice anything majorly wrong, other than some weird QC scores for a couple of files (gringer, I guess that is what you have seen as well).

        We have a script to subsample correctly, so I will probably just use that - the main problem being that it needs to read the entire file before being able to output a subsample. In that sense 'head' was a lot faster.

        gringer, as for shuf, I don't think that will work? Reason being that each read spans 2 (fasta) or 4 (fastq) lines? Otherwise, this is exactly what I would be looking for - given a file of n lines, randomly take a read from line k (so 4 lines, always starting at a position that can be divided by 4). But I haven't been able to find a script or command that will do that.

        Comment

        • maubp
          Peter (Biopython etc)
          • Jul 2009
          • 1544

          #5
          Originally posted by kga1978 View Post
          I then subsample 25.000 reads from this file using the following command:

          Code:
          head -n 100000 file.fastq.gz | <downstream analysis, e.g. blastn>
          I assume that is a typo, since you must unzip the gripped FASTQ before taking the first 1000000 lines.
          Originally posted by kga1978 View Post
          IMy worry is that by doing that, I will get some sort of bias in my analysis as I am only taking the 'head' of the first part of all my reads. The question is - is this a valid concern?
          Yes, since the read order produced by Illumina reflects the slide positions, so the first and last reads will be from the edges and generally of poorer quality (so I've read).

          Comment

          • gringer
            David Eccles (gringer)
            • May 2011
            • 845

            #6
            Originally posted by kga1978 View Post
            gringer, as for shuf, I don't think that will work? Reason being that each read spans 2 (fasta) or 4 (fastq) lines?
            You're correct... it won't work because of the serial nature of the files. Yet another case of me not thinking enough before posting.

            The only ways I can think of at the moment are fairly complex piped shell commands, or small programs.

            I guess one "simple" way to do it would be to seek to a random file position, then read forward until you find a start of sequence marker, but that's a lot of work for too little benefit. FWIW, doing a strict random seek on a fastq file is not possible because both @ and + can appear in the quality strings, and you can get multi-line fastq files.

            Edit: I've just thought of another way that would work for a single pass (i.e. could work for piped input), assuming you knew the approximate number of records in the file. You decide in advance what records will be selected (i.e. generate 1M numbers between 1 and 100M), sort the list, then run through the file and print only the records that appear in the list.
            Last edited by gringer; 12-28-2011, 04:39 PM.

            Comment

            • kga1978
              Senior Member
              • Nov 2010
              • 100

              #7
              I assume that is a typo
              Sorry, yes, that was a typo - there's a gunzip in front of that.

              So, a talented student wrote up a quick script in python for me and it works really well. It appears that it is about as fast as writing to disk, so overall what I was looking for. It takes the following argument:

              Code:
              python subsampler.py <filename> <number of sequences to extract>
              The script is as follows:

              Code:
              #!/usr/bin/env python
              import random
              import sys
              
              #name of the input file (fasta or fastq)
              #assumes input file is standard fasta/fastq format
              fileName = sys.argv[1]
              #number of sequences to subsample
              numSeq = int(sys.argv[2])
              increment = 0
              
              #if it's a fasta file
              if (fileName.find(".fasta") != -1):
                increment = 2
              #else if it's a fastq file
              elif (fileName.find(".fastq") != -1):
                increment = 4
              #quit if neither
              else:
                sys.stdout.write("not a fasta/fastq file\n")
                sys.exit()
              
              FILE = open(fileName, 'r')
              reads = list()
              index = 0
              #put the entire file in a list
              for line in FILE:
                if(index % increment == 0):
                  reads.append(line)
                else:
                  reads[(index/increment)] += line
                index += 1
              FILE.close()
              
              #figure out total number of reads, error if applicable
              totalReads = index/increment
              if(totalReads < numSeq):
                sys.stdout.write("You only have "+str(totalReads)+" reads!\n")
                sys.exit()
              
              #shuffle the reads!
              random.shuffle(reads)
              #output the reads to stdout
              for i in range(0, numSeq):
                sys.stdout.write(reads[i])

              Comment

              • gringer
                David Eccles (gringer)
                • May 2011
                • 845

                #8
                Originally posted by kga1978 View Post
                So, a talented student wrote up a quick script in python for me and it works really well. It appears that it is about as fast as writing to disk, so overall what I was looking for.
                This code is fine, but bear in mind that while this process will work on piped input (possibly with minor modifications to file opening), it requires your entire input file to be stored in memory (in the 'reads' list). If you don't care about piped input and can afford a second sweep through the file, you can reduce the memory footprint substantially by only using the first sweep to count records, then the second sweep to print out the randomly selected sequences.

                Edit: Just noticed that it won't work with multi-line FASTA or FASTQ files, but for most NGS things you don't need to worry about that.

                Comment

                • ETHANol
                  Senior Member
                  • Feb 2010
                  • 308

                  #9
                  kga1978, thanks for posting the script. I was just working on a perl script to do the same, but being a beginner at scripting it was going to take me an annoying amount of time. So thanks and now I can do something more productive today!!!
                  --------------
                  Ethan

                  Comment

                  • kga1978
                    Senior Member
                    • Nov 2010
                    • 100

                    #10
                    Hey gringer,

                    Thanks for your comments - very helpful and I'll make sure to pass them on. For now though, I don't really mind holding everything in memory - should make it faster and memory isn't a problem (for now....).

                    And actually, I won't work on stdin at the moment as it requires the .fasta or .fastq extension to work (this could be easily fixed by specifying file-type though...).

                    Comment

                    • kga1978
                      Senior Member
                      • Nov 2010
                      • 100

                      #11
                      Just to follow up on the first part of my question, I now ran a couple of subsample experiments and compared them to the entire dataset as well as to 'head -n' and 'tail -n'. As noted by other posters, there are definitely biases when doing 'head' and 'tail'.

                      I subsampled 1 million reads from a total of 50 million and ran FastQC (to calculate avg. Q-score) and aligned the reads to hg19 using BWA. This is what I got:

                      Comment

                      • kga1978
                        Senior Member
                        • Nov 2010
                        • 100

                        #12
                        Also, following gringer's suggestion, here's a less memory-hungry version of the downsampling script:

                        Code:
                        #!/usr/bin/env python
                        import random
                        import sys
                        
                        random.seed()
                        #name of the input file (fasta or fastq)
                        #assumes input file is standard fasta/fastq format
                        fileName = sys.argv[1]
                        #number of sequences to subsample
                        numSeq = int(sys.argv[2])
                        increment = 0
                        
                        #if it's a fasta file
                        if (fileName.find(".fasta") != -1):
                          increment = 2
                        #else if it's a fastq file
                        elif (fileName.find(".fastq") != -1):
                          increment = 4
                        #quit if neither
                        else:
                          sys.stdout.write("not a fasta/fastq file\n")
                          sys.exit()
                        
                        FILE = open(fileName, 'r')
                        totalReads = list()
                        index = 0
                        for line in FILE:
                          if(index % increment == 0):
                            totalReads.append(index/increment)
                          index += 1
                        FILE.close()
                        if(len(totalReads) < numSeq):
                          sys.stdout.write("You only have "+str(len(totalReads))+" reads!\n")
                          sys.exit()
                        
                        ttl = len(totalReads)
                        random.shuffle(totalReads)
                        totalReads = totalReads[0: numSeq]
                        totalReads.sort()
                        
                        FILE = open(fileName, 'r')
                        listIndex = 0
                        
                        for i in range(0, ttl):
                          curRead = ""
                          for j in range(0, increment):
                            curRead += FILE.readline()
                          if (i == totalReads[listIndex]):
                            sys.stdout.write(curRead)
                            listIndex += 1
                            if(listIndex == numSeq):
                              break
                        FILE.close()

                        Comment

                        • Adjuvant
                          Member
                          • Sep 2010
                          • 13

                          #13
                          Nobody asked for it, but I wanted it so maybe somebody else can use it, too.

                          Here's a rewrite of the python script that can now take two paired files as input and maintain pairing in the subsets. It can also still take just a single-end file as input. It's not pretty, but it does the job.

                          Changes: Now have to enter the number of reads desired first, then the input file name(s). Instead of going to stdout, the reads are output to out_1.fastq (or .fasta) and out_2.fastq (or .fasta). It would be relatively simple to put in an output prefix parameter, but this was good enough for my purposes.

                          Code:
                          #!/usr/bin/env python
                          import random
                          import sys
                          
                          random.seed()
                          #number of sequences to subsample
                          numSeq = int(sys.argv[1])
                          #name of the input file (fasta or fastq)
                          #assumes input file is standard fasta/fastq format
                          fileName1 = sys.argv[2]
                          fileName2 = sys.argv[3]
                          increment = 0
                          
                          #if it's a fasta file
                          if (fileName1.find(".fasta") != -1):
                            increment = 2
                          #else if it's a fastq file
                          elif (fileName1.find(".fastq") != -1):
                            increment = 4
                          #quit if neither
                          else:
                            sys.stdout.write("not a fasta/fastq file\n")
                            sys.exit()
                          
                          FILE1 = open(fileName1, 'r')
                          totalReads1 = list()
                          index = 0
                          for line in FILE1:
                            if(index % increment == 0):
                              totalReads1.append(index/increment)
                            index += 1
                          FILE1.close()
                          if(len(totalReads1) < numSeq):
                            sys.stdout.write("You only have "+str(len(totalReads))+" reads!\n")
                            sys.exit()
                            
                          if (fileName2):
                            FILE2 = open(fileName2, 'r')
                            totalReads2 = list()
                            index = 0
                            for line in FILE2:
                              if (index % increment == 0):
                                totalReads2.append(index/increment)
                              index += 1
                            FILE2.close()
                            if (len(totalReads1) != len(totalReads2)):
                              sys.stdout.write("read counts do not match\n")
                              sys.exit()
                          
                          ttl = len(totalReads1)
                          random.shuffle(totalReads1)
                          totalReads1 = totalReads1[0: numSeq]
                          totalReads1.sort()
                          
                          FILE1 = open(fileName1, 'r')
                          if (fileName2):
                            FILE2 = open(fileName2, 'r')
                          listIndex = 0
                          
                          if (increment == 4):
                            OUTFILE1 = open('out_1.fastq', 'w')
                            if (fileName2):
                              OUTFILE2 = open('out_2.fastq', 'w')
                          else:
                            OUTFILE1 = open('out_1.fasta', 'w')
                            if (fileName2):
                              OUTFILE2 = open('out_2.fasta', 'w')
                          
                          for i in range(0, ttl):
                            curRead1 = ""
                            curRead2 = ""
                            for j in range(0, increment):
                              curRead1 += FILE1.readline()
                              if (fileName2):
                                curRead2 += FILE2.readline()
                            if (i == totalReads1[listIndex]):
                              OUTFILE1.write(curRead1)
                              if (fileName2):
                                OUTFILE2.write(curRead2)
                              listIndex += 1
                              if(listIndex == numSeq):
                                break
                          FILE1.close()
                          if (fileName2):
                            FILE2.close()
                          OUTFILE1.close()
                          if (fileName2):
                            OUTFILE2.close()

                          Comment

                          • silver_steve
                            Junior Member
                            • Jan 2012
                            • 3

                            #14
                            Originally posted by kga1978 View Post
                            Sorry, yes, that was a typo - there's a gunzip in front of that.

                            So, a talented student wrote up a quick script in python for me and it works really well. It appears that it is about as fast as writing to disk, so overall what I was looking for. It takes the following argument:

                            Code:
                            python subsampler.py <filename> <number of sequences to extract>
                            The script is as follows:

                            Code:
                            #!/usr/bin/env python
                            import random
                            import sys
                            
                            #name of the input file (fasta or fastq)
                            #assumes input file is standard fasta/fastq format
                            fileName = sys.argv[1]
                            #number of sequences to subsample
                            numSeq = int(sys.argv[2])
                            increment = 0
                            
                            #if it's a fasta file
                            if (fileName.find(".fasta") != -1):
                              increment = 2
                            #else if it's a fastq file
                            elif (fileName.find(".fastq") != -1):
                              increment = 4
                            #quit if neither
                            else:
                              sys.stdout.write("not a fasta/fastq file\n")
                              sys.exit()
                            
                            FILE = open(fileName, 'r')
                            reads = list()
                            index = 0
                            #put the entire file in a list
                            for line in FILE:
                              if(index % increment == 0):
                                reads.append(line)
                              else:
                                reads[(index/increment)] += line
                              index += 1
                            FILE.close()
                            
                            #figure out total number of reads, error if applicable
                            totalReads = index/increment
                            if(totalReads < numSeq):
                              sys.stdout.write("You only have "+str(totalReads)+" reads!\n")
                              sys.exit()
                            
                            #shuffle the reads!
                            random.shuffle(reads)
                            #output the reads to stdout
                            for i in range(0, numSeq):
                              sys.stdout.write(reads[i])
                            Thank you kga1978. I ran this script successfully, yet the output was 1000 lines, not 1000 random sequences. I believe this is because my file is formatted like:
                            >File_Name
                            GACGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGTCTGCCTTGAAGATCGG
                            AGTGCTTGCACTCTGTGAAACAAGATACAGGCTAGCGGCGGACGGGTGAGTAACACGTGG...
                            i.e., the sequence is not one continuous string, but rather a set of lines.
                            Do you know how to modify the code or modify my files to work with subsampler.py?

                            Comment

                            • gringer
                              David Eccles (gringer)
                              • May 2011
                              • 845

                              #15
                              Edit: Just noticed that it won't work with multi-line FASTA or FASTQ files, but for most NGS things you don't need to worry about that.
                              So we have a situation that the script wasn't designed for. If you have fastx-toolkit handy, you can convert multi-line fasta files into single-line fasta files using the fasta-formatter tool, and then run through the script. Changing this script to work in a memory-efficient manner for multi-line fasta and fastq files would increase the complexity a reasonable amount.

                              A rough pseudo-code for this is as follows:

                              First pass -- counting records
                              1. Look for magic record start sequences, if found, increment the record counter
                              2. If a fasta file, read through and discard up to the next record start, return to the first step
                              3. If a fastq file, read up to the next '+' to work out sequence length
                              4. read the next line and discard
                              5. read as many quality values as were in the sequence, return to the first step

                              Second pass -- printing sequences
                              1. Generate n random numbers between 1 and the number of records
                              2. iterate through the sequences as before, but print the entire sequence record if the current record number matches to the random list

                              Comment

                              Latest Articles

                              Collapse

                              • mylaser
                                Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                by mylaser
                                Kheloyar – Everything You Need to Know About Kheloyaar Login and Kheoyar Id
                                If you are looking for an online gaming platform that offers a user-friendly experience, Kheloyar has become a name that many users search for. Whether you're interested in creating a new account, accessing your dashboard through Kheloyaar Login, or learning how to obtain a Kheoyar Id, understanding the platform's features and account process is essential.
                                This guide explains everything you need to know about...
                                Yesterday, 01:13 AM
                              • SEQadmin2
                                Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                by SEQadmin2



                                Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                ...
                                07-09-2026, 11:10 AM
                              • SEQadmin2
                                Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                by SEQadmin2



                                Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                07-08-2026, 05:17 AM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by SEQadmin2, 07-09-2026, 10:04 AM
                              0 responses
                              19 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-08-2026, 10:08 AM
                              0 responses
                              11 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-07-2026, 11:05 AM
                              0 responses
                              26 views
                              0 reactions
                              Last Post SEQadmin2  
                              Started by SEQadmin2, 07-02-2026, 11:08 AM
                              0 responses
                              31 views
                              0 reactions
                              Last Post SEQadmin2  
                              Working...