Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • adeirossi
    Member
    • Jan 2012
    • 11

    samtools: BAQ differs between mpileup and calmd

    Hello,

    Though samtools is a wonderful tool, the other day I came across a behavior that left me confused. I have found some reads in an Illumina dataset where the BAQ calculation appears to give a different result depending on whether it is performed by samtools mpileup or samtools calmd. This contradicts my assumption that BAQ-adjusted base qualities would be the same regardless of whether mpileup or calmd is used. (I am running samtools version 0.1.17 on Linux.)

    To demonstrate, I put one such read into its own BAM file and ran mpileup and calmd:

    $ samtools view my.bam
    SEQUENCER02_165:1:1207:8548:44865 99 chr3.fa 178936033 254 50M = 178936190 207 AAATGACAAAGAACAGCTCAAAGCAATTTCTACACGAGATCCTCTCTCTG CCCFFFFFHHHHHJJJJJJIJJJIJJJJJJJJJJJJJJJJIJIJJJJJJJ BC:Z:CGATGT XD:Z:50 SM:i:3 AS:i:406
    ## Here's the original base quality string.

    $ samtools calmd -Ar my.bam hg19_sorted.bam.fa
    @HD VN:1.0 SO:coordinate
    ...
    SEQUENCER02_165:1:1207:8548:44865 99 chr3.fa 178936033 254 50M = 178936190 207 AAATGACAAAGAACAGCTCAAAGCAATTTCTACACGAGATCCTCTCTCTG ;;>FFFFFHHHHHJJJJJJIJJJIJJJJJJJJJJJJJJJJIJIJJJJJJE BC:Z:CGATGT XD:Z:50 SM:i:3 AS:i:406 ZQ:Z:HHE@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@E NM:i:0 MD:Z:50
    ## Here's the BAQ-adjusted base quality string, using calmd.

    $ samtools mpileup -A -Q 0 -d 10000000 -f hg19_sorted.bam.fa my.bam
    [mpileup] 1 samples in 1 input files
    (mpileup) Max depth is above 1M. Potential memory hog!
    chr3.fa 178936033 A 1 ^~. C
    chr3.fa 178936034 A 1 . C
    chr3.fa 178936035 A 1 . C
    chr3.fa 178936036 T 1 . F
    chr3.fa 178936037 G 1 . F
    chr3.fa 178936038 A 1 . F
    chr3.fa 178936039 C 1 . F
    chr3.fa 178936040 A 1 . F
    chr3.fa 178936041 A 1 . H
    chr3.fa 178936042 A 1 . H
    chr3.fa 178936043 G 1 . H
    chr3.fa 178936044 A 1 . H
    chr3.fa 178936045 A 1 . H
    chr3.fa 178936046 C 1 . J
    chr3.fa 178936047 A 1 . J
    chr3.fa 178936048 G 1 . J
    chr3.fa 178936049 C 1 . J
    chr3.fa 178936050 T 1 . J
    chr3.fa 178936051 C 1 . J
    chr3.fa 178936052 A 1 . I
    chr3.fa 178936053 A 1 . J
    chr3.fa 178936054 A 1 . J
    chr3.fa 178936055 G 1 . J
    chr3.fa 178936056 C 1 . I
    chr3.fa 178936057 A 1 . J
    chr3.fa 178936058 A 1 . J
    chr3.fa 178936059 T 1 . J
    chr3.fa 178936060 T 1 . J
    chr3.fa 178936061 T 1 . J
    chr3.fa 178936062 C 1 . J
    chr3.fa 178936063 T 1 . J
    chr3.fa 178936064 A 1 . J
    chr3.fa 178936065 C 1 . J
    chr3.fa 178936066 A 1 . J
    chr3.fa 178936067 C 1 . J
    chr3.fa 178936068 G 1 . J
    chr3.fa 178936069 A 1 . J
    chr3.fa 178936070 G 1 . J
    chr3.fa 178936071 A 1 . J
    chr3.fa 178936072 T 1 . J
    chr3.fa 178936073 C 1 . I
    chr3.fa 178936074 C 1 . J
    chr3.fa 178936075 T 1 . I
    chr3.fa 178936076 C 1 . J
    chr3.fa 178936077 T 1 . J
    chr3.fa 178936078 C 1 . J
    chr3.fa 178936079 T 1 . J
    chr3.fa 178936080 C 1 . J
    chr3.fa 178936081 T 1 . J
    chr3.fa 178936082 G 1 .$ J
    ## Here's the BAQ-adjusted base quality string, using mpileup.
    ## Note that calmd and mpileup give different BAQ-adjusted base qualities at the start and end of the read.



    None of the following modifications to the options seems to make any difference in this case:
    • omitting the -A option with calmd
    • using the default -Q value with mpileup
    • using the -E option with mpileup


    Why do the BAQ-adjusted base qualities differ between mpileup and calmd? Any thoughts or explanation would be greatly appreciated. Thanks in advance!
  • kjohnsen
    Junior Member
    • Apr 2018
    • 1

    #2
    I haven't conducted as thorough an investigation of the matter as adeirossi, but six years later I can confirm that in the pipeline we're developing, using calmd -bAr beforehand is not yielding the same results as performing the BAQ calculation in mpileup.

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM
    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM
    • SEQadmin2
      Cancer Drug Resistance: The Lingering Barrier to Rising Survival
      by SEQadmin2



      Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

      There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
      07-08-2026, 05:17 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, Yesterday, 12:17 PM
    0 responses
    13 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-23-2026, 11:41 AM
    0 responses
    15 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-20-2026, 11:10 AM
    0 responses
    23 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-13-2026, 10:26 AM
    0 responses
    37 views
    0 reactions
    Last Post SEQadmin2  
    Working...