Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • adeirossi
    Member
    • Jan 2012
    • 11

    samtools: BAQ differs between mpileup and calmd

    Hello,

    Though samtools is a wonderful tool, the other day I came across a behavior that left me confused. I have found some reads in an Illumina dataset where the BAQ calculation appears to give a different result depending on whether it is performed by samtools mpileup or samtools calmd. This contradicts my assumption that BAQ-adjusted base qualities would be the same regardless of whether mpileup or calmd is used. (I am running samtools version 0.1.17 on Linux.)

    To demonstrate, I put one such read into its own BAM file and ran mpileup and calmd:

    $ samtools view my.bam
    SEQUENCER02_165:1:1207:8548:44865 99 chr3.fa 178936033 254 50M = 178936190 207 AAATGACAAAGAACAGCTCAAAGCAATTTCTACACGAGATCCTCTCTCTG CCCFFFFFHHHHHJJJJJJIJJJIJJJJJJJJJJJJJJJJIJIJJJJJJJ BC:Z:CGATGT XD:Z:50 SM:i:3 AS:i:406
    ## Here's the original base quality string.

    $ samtools calmd -Ar my.bam hg19_sorted.bam.fa
    @HD VN:1.0 SO:coordinate
    ...
    SEQUENCER02_165:1:1207:8548:44865 99 chr3.fa 178936033 254 50M = 178936190 207 AAATGACAAAGAACAGCTCAAAGCAATTTCTACACGAGATCCTCTCTCTG ;;>FFFFFHHHHHJJJJJJIJJJIJJJJJJJJJJJJJJJJIJIJJJJJJE BC:Z:CGATGT XD:Z:50 SM:i:3 AS:i:406 ZQ:Z:HHE@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@E NM:i:0 MD:Z:50
    ## Here's the BAQ-adjusted base quality string, using calmd.

    $ samtools mpileup -A -Q 0 -d 10000000 -f hg19_sorted.bam.fa my.bam
    [mpileup] 1 samples in 1 input files
    (mpileup) Max depth is above 1M. Potential memory hog!
    chr3.fa 178936033 A 1 ^~. C
    chr3.fa 178936034 A 1 . C
    chr3.fa 178936035 A 1 . C
    chr3.fa 178936036 T 1 . F
    chr3.fa 178936037 G 1 . F
    chr3.fa 178936038 A 1 . F
    chr3.fa 178936039 C 1 . F
    chr3.fa 178936040 A 1 . F
    chr3.fa 178936041 A 1 . H
    chr3.fa 178936042 A 1 . H
    chr3.fa 178936043 G 1 . H
    chr3.fa 178936044 A 1 . H
    chr3.fa 178936045 A 1 . H
    chr3.fa 178936046 C 1 . J
    chr3.fa 178936047 A 1 . J
    chr3.fa 178936048 G 1 . J
    chr3.fa 178936049 C 1 . J
    chr3.fa 178936050 T 1 . J
    chr3.fa 178936051 C 1 . J
    chr3.fa 178936052 A 1 . I
    chr3.fa 178936053 A 1 . J
    chr3.fa 178936054 A 1 . J
    chr3.fa 178936055 G 1 . J
    chr3.fa 178936056 C 1 . I
    chr3.fa 178936057 A 1 . J
    chr3.fa 178936058 A 1 . J
    chr3.fa 178936059 T 1 . J
    chr3.fa 178936060 T 1 . J
    chr3.fa 178936061 T 1 . J
    chr3.fa 178936062 C 1 . J
    chr3.fa 178936063 T 1 . J
    chr3.fa 178936064 A 1 . J
    chr3.fa 178936065 C 1 . J
    chr3.fa 178936066 A 1 . J
    chr3.fa 178936067 C 1 . J
    chr3.fa 178936068 G 1 . J
    chr3.fa 178936069 A 1 . J
    chr3.fa 178936070 G 1 . J
    chr3.fa 178936071 A 1 . J
    chr3.fa 178936072 T 1 . J
    chr3.fa 178936073 C 1 . I
    chr3.fa 178936074 C 1 . J
    chr3.fa 178936075 T 1 . I
    chr3.fa 178936076 C 1 . J
    chr3.fa 178936077 T 1 . J
    chr3.fa 178936078 C 1 . J
    chr3.fa 178936079 T 1 . J
    chr3.fa 178936080 C 1 . J
    chr3.fa 178936081 T 1 . J
    chr3.fa 178936082 G 1 .$ J
    ## Here's the BAQ-adjusted base quality string, using mpileup.
    ## Note that calmd and mpileup give different BAQ-adjusted base qualities at the start and end of the read.



    None of the following modifications to the options seems to make any difference in this case:
    • omitting the -A option with calmd
    • using the default -Q value with mpileup
    • using the -E option with mpileup


    Why do the BAQ-adjusted base qualities differ between mpileup and calmd? Any thoughts or explanation would be greatly appreciated. Thanks in advance!
  • kjohnsen
    Junior Member
    • Apr 2018
    • 1

    #2
    I haven't conducted as thorough an investigation of the matter as adeirossi, but six years later I can confirm that in the pipeline we're developing, using calmd -bAr beforehand is not yielding the same results as performing the BAQ calculation in mpileup.

    Comment

    Latest Articles

    Collapse

    • GATTACAT
      Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by GATTACAT
      Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
      07-01-2026, 11:43 AM
    • SEQadmin2
      Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by SEQadmin2


      I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

      Here are nine questions we think about, in roughly the order they matter, before...
      06-18-2026, 07:11 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, Yesterday, 11:08 AM
    0 responses
    6 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-30-2026, 05:37 AM
    0 responses
    11 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-26-2026, 11:10 AM
    0 responses
    19 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-17-2026, 06:09 AM
    0 responses
    53 views
    0 reactions
    Last Post SEQadmin2  
    Working...