SHRiMP doubts

[seq_GA]

Hi
I have started using SHRiMP mapping tool. And following are few doubts.

1. Do I have convert solexa reads into fasta format and then run command as below:
../SHRiMP_1_2_0/bin/rmapper-ls -s 111111011111 -n 3 -w 35 -o 20 -r 32 -d -1 -h 2675 test1.txt /../hg18/*.fa > ../results/test1.out


If I don't convert solexa sequence into fasta format (i.e appending '>' in the beginning of the sequence) then

python ../SHRiMP_1_2_0/utils/splitreads.py 1000 read1.fasta

does throw some error and I convert the reads into fasta format, then I am able to split the sequence file insto 1000 sequences per file.

But I get an error when I try to run rmapper-ls as below
../SHRiMP_1_2_0/bin/rmapper-ls -s 111111011111 -n 3 -w 35 -o 20 -r 32 -d -1 -h 2675 test1.txt /../hg18/*.fa > ../results/res.0_to_999.out

Loading reads...error: read [NATGATGCAGGAACATAAAGGACTGGTCATCTTGG] had no sequence!

Hence I changed the read format as below:
ATGCATGCGCATCGATCGATCGT
ATCGTACGATCGTACGTACGTAG
..

and run rmapper but the results are as below:

General:
Reads Matched: 0 (0.0000%)
Total Matches: 0
Avg Hits/Matched Read: 0.00
Duplicate Hits Pruned: 0

Please let me know the input query sequence format? Thanks.

[Torst]

Hi
I have started using SHRiMP mapping tool. And following are few doubts.
1. Do I have convert solexa reads into fasta format and then run command as below:
../SHRiMP_1_2_0/bin/rmapper-ls -s 111111011111 -n 3 -w 35 -o 20 -r 32 -d -1 -h 2675 test1.txt /../hg18/*.fa > ../results/test1.out
Please let me know the input query sequence format? Thanks.

The USAGE section of the Shrimp manual says:

'rmapper' performs Smith-Waterman alignments of multiple reads
within one fasta file against one or more reftigs in other fasta files.

So the reads must be in a SINGLE FASTA file and the reference sequences can be in MULTIPLE FASTA files. FASTQ is not supported. FASTA looks like this:

>read00001
AGAGAGGTATATATTTCTCATAGC
>read00002
AGGAAGAGAGGTATATATTTCTCA

Also, your parameter " /../hg18/*.fa " looks wrong.