Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Edit distance in BWA

    Hi all,
    I'm using BWA for alignment and want to get only alignments with up to 1 mismatch/ indel per read.
    So I've set the -n flag to 1, but I still get reads with a bigger edit distance..

    Code:
    SBS123:68:C00PFABXX:3:1104:7837:18918   0       MED4_genome     371700  37      2M1D48M *       0   0GAAAAAAAAAATGTAAAATATGGAACTGAATTTTTCGGAATTAATAGAGC      CCCFFFFFHHHHGHIJJIGGGHGIHIGIJIIJJJHIJIIIJIIGIIIIHF   XT:A:U  NM:i:2  X0:i:1  X1:i:0  XM:i:0  XO:i:1  XG:i:1  MD:Z:0A1^G48
    SBS123:68:C00PFABXX:3:1106:12571:108775 20      MED4_genome     1657990 25      50M     *       0   0TTGATGGTTAACAGAAATAAGAAGGTGGAAAAAAAAGCATAAATGTTGAT      FB8FDGHEHIFHEDEFB*>HDDIGIGGIIIGHFFDHGHHHFFD?FFF@@@   XT:A:U  NM:i:28 X0:i:1  X1:i:0  XM:i:1  XO:i:0  XG:i:0  MD:Z:0A0A0A1A0A0A0A0A2A1A3A2A2A0A0A0A0A0G1C5A0A1A3A0A0A0A0A1A0
    SBS123:68:C00PFABXX:3:1106:19540:193836 20      MED4_genome     1657990 25      50M     *       0   0TTGATGGTTAACAGAAATAAGAAGGTGGAAAAAAAAGCATAAATGTTGAT      EFFC83BFFB@F?<DB<9F?*F?)?C:9:EFFFFCBF<?<FADDADD:1@   XT:A:U  NM:i:28 X0:i:1  X1:i:0  XM:i:1  XO:i:0  XG:i:0  MD:Z:0A0A0A1A0A0A0A0A2A1A3A2A2A0A0A0A0A0G1C5A0A1A3A0A0A0A0A1A0
    SBS123:68:C00PFABXX:3:1107:10937:66747  0       MED4_genome     1494995 37      1M1D49M *       0   0CCCCTTTTTTTTTAATGAATCTTCTAAAGCATCACTTAAAGTTTGCATTG      @@@DABD>FDFDFBB?D>B*19?BDHCBH4B<?*9?BAHHIBH@FHDFGH   XT:A:U  NM:i:2  X0:i:1  X1:i:0  XM:i:0  XO:i:1  XG:i:1  MD:Z:1^T3C45
    SBS123:68:C00PFABXX:3:1108:2389:8959    0       MED4_genome     531215  37      3M1D47M *       0   0

    I saw an old thread about this issue, but no conclusions are written there:
    Discussion of next-gen sequencing related bioinformatics: resources, algorithms, open source efforts, etc


    What might cause this behavior of BWA?

    Thanks,
    Rachelly.

  • #2
    BWA edit distance

    Hi,
    Did you find a solution for this at all? I am getting the same problem.

    Comment


    • #3
      Hi,
      Unfortunately I didn't find the source to this phenomenon...
      What I do is filter the mappings in the SAM file and use only mappings with 1mismatch. This way I can be sure I'm using the mappings I want for the rest of the analysis.
      But it still doesn't feel very good to use a program that has an unexpected (or un-understood) behavior...

      Rachelly.

      Comment


      • #5
        Thanks for this note nupurgupta!
        I actually see that this happens with mapping of single reads as well, and not only in PE as written in the above thread - I get mappings with more mismatches than what I've asked for...
        I'm doing a filtration step after the mapping, to make sure I use only the mappings I want, but I don't understand why BWA allows to limit the amount of mismatches and then gives mappings with more mismatches..

        I tried to add a reply to the thread you've mentioned, but wasn't able to.

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Best Practices for Single-Cell Sequencing Analysis
          by seqadmin



          While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
          06-06-2024, 07:15 AM
        • seqadmin
          Latest Developments in Precision Medicine
          by seqadmin



          Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

          Somatic Genomics
          “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
          05-24-2024, 01:16 PM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, Today, 07:24 AM
        0 responses
        9 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, Yesterday, 08:58 AM
        0 responses
        11 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-12-2024, 02:20 PM
        0 responses
        16 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 06-07-2024, 06:58 AM
        0 responses
        184 views
        0 likes
        Last Post seqadmin  
        Working...
        X