Thanks for this note nupurgupta!
I actually see that this happens with mapping of single reads as well, and not only in PE as written in the above thread - I get mappings with more mismatches than what I've asked for...
I'm doing a filtration step after the mapping, to make sure I use only the mappings I want, but I don't understand why BWA allows to limit the amount of mismatches and then gives mappings with more mismatches..
I tried to add a reply to the thread you've mentioned, but wasn't able to.
Unconfigured Ad
Collapse
X
-
Hi,
Unfortunately I didn't find the source to this phenomenon...
What I do is filter the mappings in the SAM file and use only mappings with 1mismatch. This way I can be sure I'm using the mappings I want for the rest of the analysis.
But it still doesn't feel very good to use a program that has an unexpected (or un-understood) behavior...
Rachelly.
Leave a comment:
-
BWA edit distance
Hi,
Did you find a solution for this at all? I am getting the same problem.
Leave a comment:
-
Edit distance in BWA
Hi all,
I'm using BWA for alignment and want to get only alignments with up to 1 mismatch/ indel per read.
So I've set the -n flag to 1, but I still get reads with a bigger edit distance..
Code:SBS123:68:C00PFABXX:3:1104:7837:18918 0 MED4_genome 371700 37 2M1D48M * 0 0GAAAAAAAAAATGTAAAATATGGAACTGAATTTTTCGGAATTAATAGAGC CCCFFFFFHHHHGHIJJIGGGHGIHIGIJIIJJJHIJIIIJIIGIIIIHF XT:A:U NM:i:2 X0:i:1 X1:i:0 XM:i:0 XO:i:1 XG:i:1 MD:Z:0A1^G48 SBS123:68:C00PFABXX:3:1106:12571:108775 20 MED4_genome 1657990 25 50M * 0 0TTGATGGTTAACAGAAATAAGAAGGTGGAAAAAAAAGCATAAATGTTGAT FB8FDGHEHIFHEDEFB*>HDDIGIGGIIIGHFFDHGHHHFFD?FFF@@@ XT:A:U NM:i:28 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:0A0A0A1A0A0A0A0A2A1A3A2A2A0A0A0A0A0G1C5A0A1A3A0A0A0A0A1A0 SBS123:68:C00PFABXX:3:1106:19540:193836 20 MED4_genome 1657990 25 50M * 0 0TTGATGGTTAACAGAAATAAGAAGGTGGAAAAAAAAGCATAAATGTTGAT EFFC83BFFB@F?<DB<9F?*F?)?C:9:EFFFFCBF<?<FADDADD:1@ XT:A:U NM:i:28 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:0A0A0A1A0A0A0A0A2A1A3A2A2A0A0A0A0A0G1C5A0A1A3A0A0A0A0A1A0 SBS123:68:C00PFABXX:3:1107:10937:66747 0 MED4_genome 1494995 37 1M1D49M * 0 0CCCCTTTTTTTTTAATGAATCTTCTAAAGCATCACTTAAAGTTTGCATTG @@@DABD>FDFDFBB?D>B*19?BDHCBH4B<?*9?BAHHIBH@FHDFGH XT:A:U NM:i:2 X0:i:1 X1:i:0 XM:i:0 XO:i:1 XG:i:1 MD:Z:1^T3C45 SBS123:68:C00PFABXX:3:1108:2389:8959 0 MED4_genome 531215 37 3M1D47M * 0 0
I saw an old thread about this issue, but no conclusions are written there:
Discussion of next-gen sequencing related bioinformatics: resources, algorithms, open source efforts, etc
What might cause this behavior of BWA?
Thanks,
Rachelly.Tags: None
Latest Articles
Collapse
-
by SEQadmin2
The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.
This convergence of genetics, immunology, and computation...-
Channel: Articles
Yesterday, 05:41 AM -
-
by SEQadmin2
CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).
Despite this, “CRISPR helped turn genome editing from a specialized technique into...-
Channel: Articles
07-31-2026, 11:01 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, 08-24-2026, 10:32 AM
|
0 responses
42 views
0 reactions
|
Last Post
by SEQadmin2
08-24-2026, 10:32 AM
|
||
|
Started by SEQadmin2, 08-20-2026, 11:17 AM
|
0 responses
48 views
0 reactions
|
Last Post
by SEQadmin2
08-20-2026, 11:17 AM
|
||
|
Started by SEQadmin2, 08-18-2026, 10:05 AM
|
0 responses
55 views
0 reactions
|
Last Post
by SEQadmin2
08-18-2026, 10:05 AM
|
||
|
Started by SEQadmin2, 08-13-2026, 12:22 PM
|
0 responses
50 views
0 reactions
|
Last Post
by SEQadmin2
08-13-2026, 12:22 PM
|
Leave a comment: