Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts

  • Rachelly
    replied
    Thanks for this note nupurgupta!
    I actually see that this happens with mapping of single reads as well, and not only in PE as written in the above thread - I get mappings with more mismatches than what I've asked for...
    I'm doing a filtration step after the mapping, to make sure I use only the mappings I want, but I don't understand why BWA allows to limit the amount of mismatches and then gives mappings with more mismatches..

    I tried to add a reply to the thread you've mentioned, but wasn't able to.

    Leave a comment:


  • nupurgupta
    replied
    Hi,
    Actually I did figure something out for this one - see


    Hope it helps!

    Leave a comment:


  • Rachelly
    replied
    Hi,
    Unfortunately I didn't find the source to this phenomenon...
    What I do is filter the mappings in the SAM file and use only mappings with 1mismatch. This way I can be sure I'm using the mappings I want for the rest of the analysis.
    But it still doesn't feel very good to use a program that has an unexpected (or un-understood) behavior...

    Rachelly.

    Leave a comment:


  • nupurgupta
    replied
    BWA edit distance

    Hi,
    Did you find a solution for this at all? I am getting the same problem.

    Leave a comment:


  • Rachelly
    started a topic Edit distance in BWA

    Edit distance in BWA

    Hi all,
    I'm using BWA for alignment and want to get only alignments with up to 1 mismatch/ indel per read.
    So I've set the -n flag to 1, but I still get reads with a bigger edit distance..

    Code:
    SBS123:68:C00PFABXX:3:1104:7837:18918   0       MED4_genome     371700  37      2M1D48M *       0   0GAAAAAAAAAATGTAAAATATGGAACTGAATTTTTCGGAATTAATAGAGC      CCCFFFFFHHHHGHIJJIGGGHGIHIGIJIIJJJHIJIIIJIIGIIIIHF   XT:A:U  NM:i:2  X0:i:1  X1:i:0  XM:i:0  XO:i:1  XG:i:1  MD:Z:0A1^G48
    SBS123:68:C00PFABXX:3:1106:12571:108775 20      MED4_genome     1657990 25      50M     *       0   0TTGATGGTTAACAGAAATAAGAAGGTGGAAAAAAAAGCATAAATGTTGAT      FB8FDGHEHIFHEDEFB*>HDDIGIGGIIIGHFFDHGHHHFFD?FFF@@@   XT:A:U  NM:i:28 X0:i:1  X1:i:0  XM:i:1  XO:i:0  XG:i:0  MD:Z:0A0A0A1A0A0A0A0A2A1A3A2A2A0A0A0A0A0G1C5A0A1A3A0A0A0A0A1A0
    SBS123:68:C00PFABXX:3:1106:19540:193836 20      MED4_genome     1657990 25      50M     *       0   0TTGATGGTTAACAGAAATAAGAAGGTGGAAAAAAAAGCATAAATGTTGAT      EFFC83BFFB@F?<DB<9F?*F?)?C:9:EFFFFCBF<?<FADDADD:1@   XT:A:U  NM:i:28 X0:i:1  X1:i:0  XM:i:1  XO:i:0  XG:i:0  MD:Z:0A0A0A1A0A0A0A0A2A1A3A2A2A0A0A0A0A0G1C5A0A1A3A0A0A0A0A1A0
    SBS123:68:C00PFABXX:3:1107:10937:66747  0       MED4_genome     1494995 37      1M1D49M *       0   0CCCCTTTTTTTTTAATGAATCTTCTAAAGCATCACTTAAAGTTTGCATTG      @@@DABD>FDFDFBB?D>B*19?BDHCBH4B<?*9?BAHHIBH@FHDFGH   XT:A:U  NM:i:2  X0:i:1  X1:i:0  XM:i:0  XO:i:1  XG:i:1  MD:Z:1^T3C45
    SBS123:68:C00PFABXX:3:1108:2389:8959    0       MED4_genome     531215  37      3M1D47M *       0   0

    I saw an old thread about this issue, but no conclusions are written there:
    Discussion of next-gen sequencing related bioinformatics: resources, algorithms, open source efforts, etc


    What might cause this behavior of BWA?

    Thanks,
    Rachelly.

Latest Articles

Collapse

  • SEQadmin2
    How Immunogenomics Decodes Immunity’s Genetic Blueprint
    by SEQadmin2




    The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

    This convergence of genetics, immunology, and computation...
    Yesterday, 05:41 AM
  • SEQadmin2
    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
    by SEQadmin2



    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

    Despite this, “CRISPR helped turn genome editing from a specialized technique into
    ...
    07-31-2026, 11:01 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 08-24-2026, 10:32 AM
0 responses
42 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-20-2026, 11:17 AM
0 responses
48 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-18-2026, 10:05 AM
0 responses
55 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-13-2026, 12:22 PM
0 responses
50 views
0 reactions
Last Post SEQadmin2  
Working...