Thanks for this note nupurgupta!
I actually see that this happens with mapping of single reads as well, and not only in PE as written in the above thread - I get mappings with more mismatches than what I've asked for...
I'm doing a filtration step after the mapping, to make sure I use only the mappings I want, but I don't understand why BWA allows to limit the amount of mismatches and then gives mappings with more mismatches..
I tried to add a reply to the thread you've mentioned, but wasn't able to.
Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
Hi,
Unfortunately I didn't find the source to this phenomenon...
What I do is filter the mappings in the SAM file and use only mappings with 1mismatch. This way I can be sure I'm using the mappings I want for the rest of the analysis.
But it still doesn't feel very good to use a program that has an unexpected (or un-understood) behavior...
Rachelly.
Leave a comment:
-
BWA edit distance
Hi,
Did you find a solution for this at all? I am getting the same problem.
Leave a comment:
-
Edit distance in BWA
Hi all,
I'm using BWA for alignment and want to get only alignments with up to 1 mismatch/ indel per read.
So I've set the -n flag to 1, but I still get reads with a bigger edit distance..
Code:SBS123:68:C00PFABXX:3:1104:7837:18918 0 MED4_genome 371700 37 2M1D48M * 0 0GAAAAAAAAAATGTAAAATATGGAACTGAATTTTTCGGAATTAATAGAGC CCCFFFFFHHHHGHIJJIGGGHGIHIGIJIIJJJHIJIIIJIIGIIIIHF XT:A:U NM:i:2 X0:i:1 X1:i:0 XM:i:0 XO:i:1 XG:i:1 MD:Z:0A1^G48 SBS123:68:C00PFABXX:3:1106:12571:108775 20 MED4_genome 1657990 25 50M * 0 0TTGATGGTTAACAGAAATAAGAAGGTGGAAAAAAAAGCATAAATGTTGAT FB8FDGHEHIFHEDEFB*>HDDIGIGGIIIGHFFDHGHHHFFD?FFF@@@ XT:A:U NM:i:28 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:0A0A0A1A0A0A0A0A2A1A3A2A2A0A0A0A0A0G1C5A0A1A3A0A0A0A0A1A0 SBS123:68:C00PFABXX:3:1106:19540:193836 20 MED4_genome 1657990 25 50M * 0 0TTGATGGTTAACAGAAATAAGAAGGTGGAAAAAAAAGCATAAATGTTGAT EFFC83BFFB@F?<DB<9F?*F?)?C:9:EFFFFCBF<?<FADDADD:1@ XT:A:U NM:i:28 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:0A0A0A1A0A0A0A0A2A1A3A2A2A0A0A0A0A0G1C5A0A1A3A0A0A0A0A1A0 SBS123:68:C00PFABXX:3:1107:10937:66747 0 MED4_genome 1494995 37 1M1D49M * 0 0CCCCTTTTTTTTTAATGAATCTTCTAAAGCATCACTTAAAGTTTGCATTG @@@DABD>FDFDFBB?D>B*19?BDHCBH4B<?*9?BAHHIBH@FHDFGH XT:A:U NM:i:2 X0:i:1 X1:i:0 XM:i:0 XO:i:1 XG:i:1 MD:Z:1^T3C45 SBS123:68:C00PFABXX:3:1108:2389:8959 0 MED4_genome 531215 37 3M1D47M * 0 0
I saw an old thread about this issue, but no conclusions are written there:
Discussion of next-gen sequencing related bioinformatics: resources, algorithms, open source efforts, etc
What might cause this behavior of BWA?
Thanks,
Rachelly.Tags: None
Latest Articles
Collapse
-
by seqadmin
The first FDA-approved CRISPR-based therapy marked the transition of therapeutic gene editing from a dream to reality1. CRISPR technologies have streamlined gene editing, and CRISPR screens have become an important approach for identifying genes involved in disease processes2. This technique introduces targeted mutations across numerous genes, enabling large-scale identification of gene functions, interactions, and pathways3. Identifying the full range...-
Channel: Articles
08-27-2024, 04:44 AM -
-
by seqadmin
Sequencing mRNA provides a snapshot of cellular activity, allowing researchers to study the dynamics of cellular processes, compare gene expression across different tissue types, and gain insights into the mechanisms of complex diseases. “mRNA’s central role in the dogma of molecular biology makes it a logical and relevant focus for transcriptomic studies,” stated Sebastian Aguilar Pierlé, Ph.D., Application Development Lead at Inorevia. “One of the major hurdles for...-
Channel: Articles
08-07-2024, 12:11 PM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, 08-27-2024, 04:40 AM
|
0 responses
16 views
0 likes
|
Last Post
by seqadmin
08-27-2024, 04:40 AM
|
||
New Single-Molecule Sequencing Platform Introduces Advanced Features for High-Throughput Genomics
by seqadmin
Started by seqadmin, 08-22-2024, 05:00 AM
|
0 responses
293 views
0 likes
|
Last Post
by seqadmin
08-22-2024, 05:00 AM
|
||
Started by seqadmin, 08-21-2024, 10:49 AM
|
0 responses
135 views
0 likes
|
Last Post
by seqadmin
08-21-2024, 10:49 AM
|
||
Started by seqadmin, 08-19-2024, 05:12 AM
|
0 responses
124 views
0 likes
|
Last Post
by seqadmin
08-19-2024, 05:12 AM
|
Leave a comment: