Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Rachelly
    replied
    Thanks for this note nupurgupta!
    I actually see that this happens with mapping of single reads as well, and not only in PE as written in the above thread - I get mappings with more mismatches than what I've asked for...
    I'm doing a filtration step after the mapping, to make sure I use only the mappings I want, but I don't understand why BWA allows to limit the amount of mismatches and then gives mappings with more mismatches..

    I tried to add a reply to the thread you've mentioned, but wasn't able to.

    Leave a comment:


  • nupurgupta
    replied
    Hi,
    Actually I did figure something out for this one - see


    Hope it helps!

    Leave a comment:


  • Rachelly
    replied
    Hi,
    Unfortunately I didn't find the source to this phenomenon...
    What I do is filter the mappings in the SAM file and use only mappings with 1mismatch. This way I can be sure I'm using the mappings I want for the rest of the analysis.
    But it still doesn't feel very good to use a program that has an unexpected (or un-understood) behavior...

    Rachelly.

    Leave a comment:


  • nupurgupta
    replied
    BWA edit distance

    Hi,
    Did you find a solution for this at all? I am getting the same problem.

    Leave a comment:


  • Rachelly
    started a topic Edit distance in BWA

    Edit distance in BWA

    Hi all,
    I'm using BWA for alignment and want to get only alignments with up to 1 mismatch/ indel per read.
    So I've set the -n flag to 1, but I still get reads with a bigger edit distance..

    Code:
    SBS123:68:C00PFABXX:3:1104:7837:18918   0       MED4_genome     371700  37      2M1D48M *       0   0GAAAAAAAAAATGTAAAATATGGAACTGAATTTTTCGGAATTAATAGAGC      CCCFFFFFHHHHGHIJJIGGGHGIHIGIJIIJJJHIJIIIJIIGIIIIHF   XT:A:U  NM:i:2  X0:i:1  X1:i:0  XM:i:0  XO:i:1  XG:i:1  MD:Z:0A1^G48
    SBS123:68:C00PFABXX:3:1106:12571:108775 20      MED4_genome     1657990 25      50M     *       0   0TTGATGGTTAACAGAAATAAGAAGGTGGAAAAAAAAGCATAAATGTTGAT      FB8FDGHEHIFHEDEFB*>HDDIGIGGIIIGHFFDHGHHHFFD?FFF@@@   XT:A:U  NM:i:28 X0:i:1  X1:i:0  XM:i:1  XO:i:0  XG:i:0  MD:Z:0A0A0A1A0A0A0A0A2A1A3A2A2A0A0A0A0A0G1C5A0A1A3A0A0A0A0A1A0
    SBS123:68:C00PFABXX:3:1106:19540:193836 20      MED4_genome     1657990 25      50M     *       0   0TTGATGGTTAACAGAAATAAGAAGGTGGAAAAAAAAGCATAAATGTTGAT      EFFC83BFFB@F?<DB<9F?*F?)?C:9:EFFFFCBF<?<FADDADD:1@   XT:A:U  NM:i:28 X0:i:1  X1:i:0  XM:i:1  XO:i:0  XG:i:0  MD:Z:0A0A0A1A0A0A0A0A2A1A3A2A2A0A0A0A0A0G1C5A0A1A3A0A0A0A0A1A0
    SBS123:68:C00PFABXX:3:1107:10937:66747  0       MED4_genome     1494995 37      1M1D49M *       0   0CCCCTTTTTTTTTAATGAATCTTCTAAAGCATCACTTAAAGTTTGCATTG      @@@DABD>FDFDFBB?D>B*19?BDHCBH4B<?*9?BAHHIBH@FHDFGH   XT:A:U  NM:i:2  X0:i:1  X1:i:0  XM:i:0  XO:i:1  XG:i:1  MD:Z:1^T3C45
    SBS123:68:C00PFABXX:3:1108:2389:8959    0       MED4_genome     531215  37      3M1D47M *       0   0

    I saw an old thread about this issue, but no conclusions are written there:
    Discussion of next-gen sequencing related bioinformatics: resources, algorithms, open source efforts, etc


    What might cause this behavior of BWA?

    Thanks,
    Rachelly.

Latest Articles

Collapse

  • seqadmin
    Exploring Human Diversity Through Large-Scale Omics
    by seqadmin


    In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
    Today, 06:43 AM
  • seqadmin
    Best Practices for Single-Cell Sequencing Analysis
    by seqadmin



    While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
    06-06-2024, 07:15 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 06-21-2024, 07:49 AM
0 responses
15 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-20-2024, 07:23 AM
0 responses
16 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-17-2024, 06:54 AM
0 responses
18 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-14-2024, 07:24 AM
0 responses
28 views
0 likes
Last Post seqadmin  
Working...
X