Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Rachelly
    Member
    • Oct 2010
    • 37

    Edit distance in BWA

    Hi all,
    I'm using BWA for alignment and want to get only alignments with up to 1 mismatch/ indel per read.
    So I've set the -n flag to 1, but I still get reads with a bigger edit distance..

    Code:
    SBS123:68:C00PFABXX:3:1104:7837:18918   0       MED4_genome     371700  37      2M1D48M *       0   0GAAAAAAAAAATGTAAAATATGGAACTGAATTTTTCGGAATTAATAGAGC      CCCFFFFFHHHHGHIJJIGGGHGIHIGIJIIJJJHIJIIIJIIGIIIIHF   XT:A:U  NM:i:2  X0:i:1  X1:i:0  XM:i:0  XO:i:1  XG:i:1  MD:Z:0A1^G48
    SBS123:68:C00PFABXX:3:1106:12571:108775 20      MED4_genome     1657990 25      50M     *       0   0TTGATGGTTAACAGAAATAAGAAGGTGGAAAAAAAAGCATAAATGTTGAT      FB8FDGHEHIFHEDEFB*>HDDIGIGGIIIGHFFDHGHHHFFD?FFF@@@   XT:A:U  NM:i:28 X0:i:1  X1:i:0  XM:i:1  XO:i:0  XG:i:0  MD:Z:0A0A0A1A0A0A0A0A2A1A3A2A2A0A0A0A0A0G1C5A0A1A3A0A0A0A0A1A0
    SBS123:68:C00PFABXX:3:1106:19540:193836 20      MED4_genome     1657990 25      50M     *       0   0TTGATGGTTAACAGAAATAAGAAGGTGGAAAAAAAAGCATAAATGTTGAT      EFFC83BFFB@F?<DB<9F?*F?)?C:9:EFFFFCBF<?<FADDADD:1@   XT:A:U  NM:i:28 X0:i:1  X1:i:0  XM:i:1  XO:i:0  XG:i:0  MD:Z:0A0A0A1A0A0A0A0A2A1A3A2A2A0A0A0A0A0G1C5A0A1A3A0A0A0A0A1A0
    SBS123:68:C00PFABXX:3:1107:10937:66747  0       MED4_genome     1494995 37      1M1D49M *       0   0CCCCTTTTTTTTTAATGAATCTTCTAAAGCATCACTTAAAGTTTGCATTG      @@@DABD>FDFDFBB?D>B*19?BDHCBH4B<?*9?BAHHIBH@FHDFGH   XT:A:U  NM:i:2  X0:i:1  X1:i:0  XM:i:0  XO:i:1  XG:i:1  MD:Z:1^T3C45
    SBS123:68:C00PFABXX:3:1108:2389:8959    0       MED4_genome     531215  37      3M1D47M *       0   0

    I saw an old thread about this issue, but no conclusions are written there:
    Discussion of next-gen sequencing related bioinformatics: resources, algorithms, open source efforts, etc


    What might cause this behavior of BWA?

    Thanks,
    Rachelly.
  • nupurgupta
    Member
    • Aug 2010
    • 29

    #2
    BWA edit distance

    Hi,
    Did you find a solution for this at all? I am getting the same problem.

    Comment

    • Rachelly
      Member
      • Oct 2010
      • 37

      #3
      Hi,
      Unfortunately I didn't find the source to this phenomenon...
      What I do is filter the mappings in the SAM file and use only mappings with 1mismatch. This way I can be sure I'm using the mappings I want for the rest of the analysis.
      But it still doesn't feel very good to use a program that has an unexpected (or un-understood) behavior...

      Rachelly.

      Comment

      • Rachelly
        Member
        • Oct 2010
        • 37

        #5
        Thanks for this note nupurgupta!
        I actually see that this happens with mapping of single reads as well, and not only in PE as written in the above thread - I get mappings with more mismatches than what I've asked for...
        I'm doing a filtration step after the mapping, to make sure I use only the mappings I want, but I don't understand why BWA allows to limit the amount of mismatches and then gives mappings with more mismatches..

        I tried to add a reply to the thread you've mentioned, but wasn't able to.

        Comment

        Latest Articles

        Collapse

        • SEQadmin2
          From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
          by SEQadmin2


          Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


          The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
          ...
          06-02-2026, 10:05 AM
        • SEQadmin2
          Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends
          by SEQadmin2


          With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.


          Introduction

          Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
          05-22-2026, 06:42 AM
        • SEQadmin2
          Environmental Genomics in the Age of NGS: From Microbes to Conservation Strategies
          by SEQadmin2

          Studying ecosystems means dealing with complex, multi-species communities that are hard to observe at scale. This complexity, however, hides many important questions to be answered, from how biogeochemical cycles work and how climate change can affect species distribution to how conservation strategies can work best.


          Genomics, particularly since the expansion of NGS, has transformed ecosystem ecology. By sequencing environmental DNA, we can now assess biodiversity without direct...
          05-06-2026, 09:04 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by SEQadmin2, Yesterday, 08:59 AM
        0 responses
        14 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 06-02-2026, 12:03 PM
        0 responses
        22 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 06-02-2026, 11:40 AM
        0 responses
        19 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 05-28-2026, 11:40 AM
        0 responses
        32 views
        0 reactions
        Last Post SEQadmin2  
        Working...