reformat sam file

[maria_mari]

hi everybody I have a bam file that after I converted it to sam is like:

sq402659 chr1 3000097 255 100M * 0 0 ACCTTATCTTTACCTTATTTATTCTAAATTTTTTACAA * AS:i:0

I need to convert it to a sam format containing "NM:i:" and quality scores like "GDGDG=A@#@B@B?BG@ ..." as well

could someone help me please?

[sdvie]

Hi Maria!

Do you have the original reads files containing the base qualities? Then you could extract the qualities string for each readID (first field in the sam file) and add it to your current sam file after the sequence field.

About the NM field, possibly the value (edit distance) may be extracted from the CIGAR string field (100M in your example line). See here for detailed specifications of the sam format fields.

maybe that helps,
cheers,
Sophia

[maria_mari]

Hi Spphia
Thanks for your reply
I have the fastq file
would you please tell me how can I do that?

[sdvie]

What program are you using for alignment?
I have used several and I believe they all added the qualities to the sam output by default...

[maria_mari]

Is there any problem with bam to sam converting? Is there any option that I've missed it?

[sdvie]

No, the qualities will be neither in the bam nor when you are viewing it as sam.
But it would take a dedicated script to include the base qualities field.
Or does anyone know whether this information can be added using any of the sam file manipulation tools?

cheers,
Sophia