Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • sehrrot
    Member
    • Jul 2010
    • 58

    #1

    Picard Error: IllegalArgumentException: Invalid fastq character:

    hi all

    I'm having trouble in using Picard to covert sam to bam. it seems to be halted by weird characters (I cannot type it here)

    Ignoring SAM validation error due to lenient parsing:
    Error parsing text SAM file. length(QUAL) != length(SEQ); Line 28
    Line: DFCDZDN1:130:B01D5ACXX:4:1101:1099:2046 99 chr3 134076497 60 100M = 134076563 166 AGGGCAGAGGAGGGGAGAGAATGGCTCAGAGTCCTGAAGCACCACCTCCTTCAGATCAGTATCTCCACCATGTCTGACAAGTCCTGGANTCTGGATGTAG $$$''''%)))))++*+((**+*+++++**+'))++**++**+**+(*)++++))))()'''''''%&%%$$"$&%$$$$%"$%$%% (weird character here)
    [Thu Feb 23 15:13:19 EST 2012] net.sf.picard.sam.SortSam done. Elapsed time: 0.00 minutes.
    Runtime.totalMemory()=123666432
    Exception in thread "main" java.lang.IllegalArgumentException: Invalid fastq character: (weird character here)
    at net.sf.samtools.SAMUtils.fastqToPhred(SAMUtils.java:408)
    at net.sf.samtools.SAMUtils.fastqToPhred(SAMUtils.java:387)
    at net.sf.samtools.SAMRecord.setBaseQualityString(SAMRecord.java:254)
    at net.sf.samtools.SAMTextReader$RecordIterator.parseLine(SAMTextReader.java:422)
    at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:278)
    at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:250)
    at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:641)
    at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:619)
    at net.sf.picard.sam.SortSam.doWork(SortSam.java:67)
    at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:177)
    at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:119)
    at net.sf.picard.sam.SortSam.main(SortSam.java:79)
  • swbarnes2
    Senior Member
    • May 2008
    • 910

    #2
    Either the fastq was made wrongly, or the .sam was made wrongly. Those are not normal quality characters.
    Last edited by swbarnes2; 02-22-2012, 10:18 PM.

    Comment

    • maubp
      Peter (Biopython etc)
      • Jul 2009
      • 1544

      #3
      What is the weird characters? Try using hexdump.

      Comment

      • sehrrot
        Member
        • Jul 2010
        • 58

        #4
        Hi all

        now it's working fine after I removed "-I" from bwa alignment process ("bwa aln -t 4 -f input.sai -I hg19 input.fastq")

        Comment

        • maubp
          Peter (Biopython etc)
          • Jul 2009
          • 1544

          #5
          So you probably have Sanger style FASTQ, which is what the latest Illumina pipeline produces - but you told bwa it was the legacy Illumina specific FASTQ encoding.

          See:


          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
            by SEQadmin2



            CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

            Despite this, “CRISPR helped turn genome editing from a specialized technique into
            ...
            07-31-2026, 11:01 AM
          • SEQadmin2
            Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
            by SEQadmin2


            Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

            The systematic characterization of the human proteome has
            ...
            07-20-2026, 11:48 AM
          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            07-09-2026, 11:10 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, 07-31-2026, 02:55 AM
          0 responses
          14 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-24-2026, 12:17 PM
          0 responses
          15 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-23-2026, 11:41 AM
          0 responses
          13 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-20-2026, 11:10 AM
          0 responses
          24 views
          0 reactions
          Last Post SEQadmin2  
          Working...