Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • muzz56
    Member
    • Sep 2010
    • 14

    Maq error:[seq_read_fastq] Inconsistent sequence name

    Hi,
    I've been dowloaded some Illumina/Solexa short read files from SRA such as this one:

    @CCFFFFEFHHGHJJJJJGIIEHGIIJJGIIEGIEBGIJEEFFFFCFFFCDEDDDDDDDDDDDDDDDDBA@CDEEDCDCDDDDCCDCDBDDDDDDCCCDC
    @SRR350739.3 SOLEXA4_0073:2:1101:1220:2247 length=100
    CGAGATATTCAAGATTTCTCTGCTGCTTGTCAGTTGAGAGCGTTGCGATTGGATTCCCGTTCCTCCCCTTGGCTTCGGCTCAGTTCGTCCTTTAACATCA
    +SRR350739.3 SOLEXA4_0073:2:1101:1220:2247 length=100
    CCCFFFFFHHHDHHHIFIJIJIJIIIIJGIJIIJJIEIIJJJJIIIJEHGEHHIGIGHJIIIIIJHHHGFFFFFEEDDBDB>CCDCDDBDDDD>@CCC>C
    @SRR350739.4 SOLEXA4_0073:2:1101:1320:2116 length=100
    CACAAGGTCCCGGAACACACCACGCGTTGCGGCAGCGGCCATGAACACGGACAAAATACTGCGAGCCAATGCTGGGACCAAATCGCTAATCGTTCGCGAA
    +SRR350739.4 SOLEXA4_0073:2:1101:1320:2116 length=100
    CCCFFFFFHHHHHJJJJJJJJIJJJJJJIJJJJIFHHFFDDDDDDDDDDDBDDDDDDDDDEDDBDDDDDDDDDDDDDDDBBDDDDDDDDDDDDDDDDDDD

    and while trying to use the file in maq with the easy run command:

    maq.pl easyrun -d outdir ref.fasta reads.fastq

    I get this error :

    [seq_read_fastq] Inconsistent sequence name: CA>ACDADDDDCCB(<AC@@BBD-<99<?CD. Continue anyway.
    [seq_read_fastq] Inconsistent sequence name: BDBDBDDCDDA9A?<BCCCC>B. Continue anyway.
    [seq_read_fastq] Inconsistent sequence name: 5ACDDDDDCDDDDD. Continue anyway.
    [seq_read_fastq] Inconsistent sequence name: BDCABDDDDDDDDDBDCCCBDDBDBA<. Continue anyway.
    [seq_read_fastq] Inconsistent sequence name: CDC. Continue anyway

    A quick search around reveals that probably this error is due to spaces in the sequence name. Normally I'd remove the spaces in vim editor but these are huge files which can't even open in vim editor.

    Does anyone know an easy way to remove spaces in the sequence name or if I have a different problem other than spaces in sequence name?

    Thanks in advance.
  • maubp
    Peter (Biopython etc)
    • Jul 2009
    • 1544

    #2
    It looks like a different problem - those are not sequence names it is showing, but bits of quality strings.

    Comment

    Latest Articles

    Collapse

    • GATTACAT
      Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by GATTACAT
      Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
      Yesterday, 11:43 AM
    • SEQadmin2
      Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by SEQadmin2


      I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

      Here are nine questions we think about, in roughly the order they matter, before...
      06-18-2026, 07:11 AM
    • SEQadmin2
      From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
      by SEQadmin2


      Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


      The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
      ...
      06-02-2026, 10:05 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 06-30-2026, 05:37 AM
    0 responses
    9 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-26-2026, 11:10 AM
    0 responses
    18 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-17-2026, 06:09 AM
    0 responses
    52 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-09-2026, 11:58 AM
    0 responses
    110 views
    0 reactions
    Last Post SEQadmin2  
    Working...