How to trim multiple alignment?

[*#1*]

I have a specific problem. We want to discover isoforms of a gene based on long reads. We have a population of overlapping sequences all under 1000bp. I aligned them with Clustal, and now would like to trim the edges so that only common area for all sequences is remained.
So, I need to convert alignment like this:

>>>>>>>>>>atgcatgcatgcqtgatgctgatgctagtgctagtgctagtcgtagctga
gcatgcatgcatgcatgcatgcqtgatgctgatgctagtgctagtgcta
>>>>>>catgcatgcatgcatgcqtgatgctgatgctagtg
>>>>>>>>>>>>gcatgcatgcatgcqtgatgctgatgctagtgctagt


to
atgcatgcatgcqtgatgctgatgctagtg
atgcatgcatgcqtgatgctgatgctagtg
atgcatgcatgcqtgatgctgatgctagtg
atgcatgcatgcqtgatgctgatgctagtg


Is there a way to do that in Linux? Right now the alignment is in CLC Bio, but I can export it to SAM/BAM or possibly to text as well.

My understanding is that if I trim produce a text file with the alignment, I can then run uniq -c command in Linux and get both unique sequences in my list, and counts (-c) for each of them.

Any advise on how to do that best are appreciated. I am not too handy with PERL or Python though, so shell scripts or some unix tricks would be more desirable.

Thanks!

Thanks for any input

[maubp]

Avoiding Perl or Python (which is how I would do this), many biologists I know used to or still use BioEdit for that kind of thing, but it is Windows only and dead software. You might try JalView http://www.jalview.org/ or UGENE http://ugene.unipro.ru/ which are both free, open source and cross platform.

[*#1*]

Thank you for the reply. I can certainly do simple Perl and Python, but I am not sure how to approach the problem. If you have ready to use scripts, I'd appreciate your posting them here.
Thanks!