bowtie option -l -n

[StephaniePi83]

Hello everybody,

I have to map small reads (15 to 29 nt ) on transcripts in order to find gene that are targetted by a small class of ncRNA. nothing in known about this targetting, but i need to put a seed length of 16nt with no mismatches.
Attached is a picture showing the kind of targetting we are searching for.
I run bowtie with the following option :

bowtie -l 16 -n 0 -v 3 --nofw -t transcript_clip -c AATTGAATAAATATATGTCAG

, but no alignement is returned.
I would like to know if an option exist to tell bowtie that only the seed is take into account during the mapping, not the remaining sequence ...

Thanks in advance for your help.

[twaddlac]

'-v' and '-n' are mutually exclusive and bowtie will not run. So to set the number of mismatches in your seed it would just be '-n 0'

I hope this helps!

[StephaniePi83]

Yes i know, but even when i run

bowtie -l 16 -n 0 --nofw -t transcript_clip -c AATTGAATAAATATATGTCAGC

i have no alignment.
I was thinking that bowtie2 can do this but it seems not .... anyone can help me ?

[tomc]

I have used
bowtie --best -strata ...

in that situation with success

[StephaniePi83]

I solve the problem by setting a high value to the maximum permitted total of quality values :

bowtie -l 16 -n 0 -e 1000 --nofw  transcript_clip -c AATTGAATAAATATATGTCAGCC

[unique379]

Hey Stephanie,

why you are suppose to have --nofw option ???