Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Problem using HTSeq count with SAM file without quality score

    Hi everyone,

    I have a problem using HTSeq count to analyse my SAM file. I think I know the source of the error and I'm wondering whether there is a work around.

    The SAM files I'm dealing with don't have any quality scores as they were made by aligning fasta files to the reference using segemehl. They look like

    @HD VN:1.0
    @SQ SN:gi|153930785|ref|NC_009697.1| LN:3863450
    @PG ID:segemehl VN:0.1.3-$Rev: 335 $ ($Date: 2012-03-13 18:55:51 +0100 (Tue, 13 Mar 2012) $) CL:/usr/local/segemehl/segemehl.x -i cbot19397.idx -d Cbot19397.fasta -q /Volumes/DataRAID/Projects/Phil_RNA_SEQ/170112/fasta/14_trimmed.fa -t 6 -E 0.0001
    Noname 0 gi|153930785|ref|NC_009697.1| 1577456 255 25M1I11M * 0 0 TATAAAATATAATAATATATATATATATATATATATA * NM:i:3 MD:Z:19A7T8 NH:i:1 XA:Z:Q
    Noname 0 gi|153930785|ref|NC_009697.1| 3243930 255 49M1D1M * 0 0 ATAGTAACAACAATAATAACAATAACGACAATAACAACAATACTAAACCC * NM:i:1 MD:Z:49^T1 NH:i:1 XA:Z:Q
    Noname 0 gi|153930785|ref|NC_009697.1| 59594 255 17M1D4M1I28M * 0 0 CAAGATGAGATTTCCCAATCGCTAAGCTAGTAAGACTCCTGGAAGAACAC * NM:i:3 MD:Z:17^T1G30 NH:i:7 XA:Z:Q
    Noname 0 gi|153930785|ref|NC_009697.1| 458627 255 17M1I4M1D28M * 0 0 CAAGATGAGATTTCCCAATCGCTAAGCTAGTAAGACTCCTGGAAGAACAC * NM:i:3 MD:Z:18A2^A28 NH:i:7 XA:Z:Q
    Noname 0 gi|153930785|ref|NC_009697.1| 52967 255 17M1D4M1I28M * 0 0 CAAGATGAGATTTCCCAATCGCTAAGCTAGTAAGACTCCTGGAAGAACAC * NM:i:3 MD:Z:17^T1G30 NH:i:7 XA:Z:Q
    Noname 0 gi|153930785|ref|NC_009697.1| 67539 255 17M1D4M1I28M * 0 0 CAAGATGAGATTTCCCAATCGCTAAGCTAGTAAGACTCCTGGAAGAACAC * NM:i:3 MD:Z:17^T1G30 NH:i:7 XA:Z:Q
    Noname 0 gi|153930785|ref|NC_009697.1| 73821 255 17M1D4M1I28M * 0 0 CAAGATGAGATTTCCCAATCGCTAAGCTAGTAAGACTCCTGGAAGAACAC * NM:i:3 MD:Z:17^T1G30 NH:i:7 XA:Z:Q

    As you can see, there is a * instead of a qual string. When I try to use HTSeq count by inputting

    python -m HTSeq.scripts.count -t CDS -m intersection-nonempty -i Name -a 0 14_trimmed_fasta_v2.sam CP000726.gff

    It returns

    7465 GFF lines processed.
    Error occured when reading first line of sam file.
    Error: ("'seq' and 'qualstr' do not have the same length.", 'line 4 of file 14_trimmed_fasta_v2.sam')
    [Exception type: ValueError, raised in _HTSeq.pyx:765]

    I have tried setting the -a parameter to 0 and * with no positive effect. I think that HTSeq is expecting a quality string which my SAM file doesn't have.

    Does anyone know a way around this problem?

    Thanks,

  • #2
    Duplicate thread - see http://seqanswers.com/forums/showthread.php?t=18952 where Simon Anders confirmed this was a known issue.

    Comment


    • #3
      Thanks Peter, apologies for the duplicate.

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Current Approaches to Protein Sequencing
        by seqadmin


        Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
        04-04-2024, 04:25 PM
      • seqadmin
        Strategies for Sequencing Challenging Samples
        by seqadmin


        Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
        03-22-2024, 06:39 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 04-11-2024, 12:08 PM
      0 responses
      31 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-10-2024, 10:19 PM
      0 responses
      32 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-10-2024, 09:21 AM
      0 responses
      28 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-04-2024, 09:00 AM
      0 responses
      53 views
      0 likes
      Last Post seqadmin  
      Working...
      X