Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • bowtie2 quality scores same for every read

    Dear all,

    I am trying to map Illumina 2x126bp exome data (Nimblegen v3) with bowtie2. Subsequently, I want to perform variant detection using Samtools.

    I ran into following problem:
    - When I do an end-to-end paired-end mapping with bowtie2, the resulting sam file shows a mapping quality (column 5, MAPQ) of 0 for every read.
    - When I do a local paired-end mapping with bowtie2, the resulting sam file shows a mapping quality (column 5, MAPQ) of 44 for every read.
    - Note: both end-to-end and local mapping of the same reads but as single end reads shows a MAPQ value ranging between 1 and 44 (local) or between 1 and 42 (end-to-end)

    Example sam output end-to-end:
    bowtie2 --very-sensitive -p 8 --no-mixed --no-discordant -x ./bowtie2_hg19/hg19 -1 F10_GCCAAT_L007_R1.fastq -2 F10_GCCAAT_L007_R2.fastq -S F10_ete.sam --met-file F10_ete.out
    HISEQ:126:C0HL2ACXX:7:1101:5336:1952 83 chr19 8841203 0 126M = 8841061 -268 TTAAGTTTTCTCCCTCCAGCCTACTGATTCTAGCTGCAGCCTCATTCCTCTTCTCAAGACACCATCCCAGGAAGCCACCACCAATCAATGATGATTGGCATGTGAGATGAAAATTATTTGCCACCC ####A?9(09.0?88B@A::A>@@>>@A@A>CA::BBBBCCCCA;6(67;7B?7==.)(=)GHFC@=8)<HEBD?700):FHGGFDF?GHGIHHG@IIGF<DH@<H@IGGHF<>FBCABDDDA@@@ AS:i:-4 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:46A31T47 YT:Z:CP
    HISEQ:126:C0HL2ACXX:7:1101:5336:1952 163 chr19 8841061 0 126M = 8841203 268 TGAGGCACCACGTCCGGCCGAACCTCAAATTTTTCACTATAGGGAGCAGTGGGTAGCTCTTCATTGGAGTGTGGCCAAGCGTCTCATTCAGAGATGCCAGCTGCTTCTTTGCCATCCCATGCCTTG @<@DFFFDBFBBFBGIIIGIJJJJ<9DH8DFGIIC8BGIEGHII>GIEE7=AA?BDCCCCA@CAA;CA?CDDDD?ACBB?BB?B?@DEECC::A@C4@A@BCC9CCCDDD((4@@A88:@C?::AC AS:i:-2 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:110C15 YT:Z:CP


    Example sam output local alignment:
    bowtie2 --very-sensitive-local --local -M 5 --score-min G,20,8 -p 8 --no-mixed --no-discordant -x ./bowtie2_hg19/hg19 -1 F10_GCCAAT_L007_R1.fastq -2 F10_GCCAAT_L007_R2.fastq -S F10_local.sam --met-file F10_local.out
    HISEQ:126:C0HL2ACXX:7:1101:5336:1952 83 chr19 8841203 44 126M = 8841061 -268 TTAAGTTTTCTCCCTCCAGCCTACTGATTCTAGCTGCAGCCTCATTCCTCTTCTCAAGACACCATCCCAGGAAGCCACCACCAATCAATGATGATTGGCATGTGAGATGAAAATTATTTGCCACCC ####A?9(09.0?88B@A::A>@@>>@A@A>CA::BBBBCCCCA;6(67;7B?7==.)(=)GHFC@=8)<HEBD?700):FHGGFDF?GHGIHHG@IIGF<DH@<H@IGGHF<>FBCABDDDA@@@ AS:i:244 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:46A31T47 YT:Z:CP
    HISEQ:126:C0HL2ACXX:7:1101:5336:1952 163 chr19 8841061 44 126M = 8841203 268 TGAGGCACCACGTCCGGCCGAACCTCAAATTTTTCACTATAGGGAGCAGTGGGTAGCTCTTCATTGGAGTGTGGCCAAGCGTCTCATTCAGAGATGCCAGCTGCTTCTTTGCCATCCCATGCCTTG @<@DFFFDBFBBFBGIIIGIJJJJ<9DH8DFGIIC8BGIEGHII>GIEE7=AA?BDCCCCA@CAA;CA?CDDDD?ACBB?BB?B?@DEECC::A@C4@A@BCC9CCCDDD((4@@A88:@C?::AC AS:i:248 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:110C15 YT:Z:CP

    Who can make sense of this? Thanks! I already spend a day on this.

    Kind regards,
    Filip

  • #2
    I want to bump this question. Mapping paired-end reads with bowtie2 should be common practice. Right? I cannot imagine that nobody elso ran in to this problem. Am I overlooking something really obvious? In the mean time, I helped myself by switching to bwa. I still want to make the bowtie2 approach work, because of speed issues and the local aligment features. Where are the Bowtie aficionados?

    Comment


    • #3
      Hi Filip,

      The same problem here (end to end, MapQual all 0s. However, this only happened when --no-mixed --no-discordant options were used. Find the parameters below:

      bowtie2 -p 6 --phred33 -N 1 -L 25 -X 650 -I 0 --no-mixed --no-discordant --un-conc ****_un.fastq --al-conc ****_al.fastq --rg-id Flowcell1_Lane4 --rg LB:Lib-**** --rg SM:*** --rg PL:HiSeq2000 -x $bowtie2_reference_dir/genome -1 $rawi/****_1.fq -2 $rawi/****_2.fq -S ****.sam >> ****.out 2>&1

      I found no issues when run in --non-mixed mode only. Find commands below:

      bowtie2 -p 6 --phred33 -N 1 -L 25 -X 650 -I 0 --no-mixed --rg-id Flowcell1_Lane4 --rg LB:Lib-**** --rg SM:*** --rg PL:HiSeq2000 -x $bowtie2_reference_dir/genome -1 $rawi/****_1.fq -2 $rawi/****_2.fq -S ****.sam >> ****.out 2>&1

      I hope this helps.

      Cheers,

      Fernando

      Comment


      • #4
        Thanks Fernando! Indeed, the problem only occurs when using --no-mixed and --no-discordant. I reported this bug to the sourceforge.net site.

        Comment


        • #5
          Excellent! Thanks.
          Cheers,
          Fernando

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Best Practices for Single-Cell Sequencing Analysis
            by seqadmin



            While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
            06-06-2024, 07:15 AM
          • seqadmin
            Latest Developments in Precision Medicine
            by seqadmin



            Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

            Somatic Genomics
            “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
            05-24-2024, 01:16 PM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, Today, 07:23 AM
          0 responses
          8 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 06-17-2024, 06:54 AM
          0 responses
          12 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 06-14-2024, 07:24 AM
          0 responses
          24 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 06-13-2024, 08:58 AM
          0 responses
          18 views
          0 likes
          Last Post seqadmin  
          Working...
          X