current version of tbl2asn for linux

[anna_]

Hi,

I am trying to create an .sql file to upload it at NCBI TSA database. My input is a de novo assembly of approx. 20 000 contigs as .fsa. From the NCBI webpage I got the information that I should use tbl2asn for this.

Now I got the error: "This copy of tbl2asn is more than one year old. Please download the current version."

My output is empty and I don't get a different error massage.

I cannot find something else than the 14.3 release in the FTP directory of NCBI, but the instruction say one should use higher than 19.3.

Heeeelp,

anna.

[anna_]

I am relpying to my own post:

I think the old version of tbl2asn is not the problem. Instead:

The TSA NCBI page says I should include an assembly.cmt file with the argument -w assembly.cmt. As soon as I write this in the command tbl2asn doesn't do anything anymore.

Is there somebody who already submitted a batch-file to TSA (transcriptome sequence assembly) database and who used tbl2asn for this?

Can anybody tell me why there is no -w argument in the documentation of tbl2asn but at the TSA information page?

[Tuinhof]

I have the same problem. I have downloaded the newest version (14-06-2012) of the NCBI website, and still I get an error.
Can someone help us?

[anna_]

I don't know if you have the same problem than me. I could solve my problem finally by specifying the molecule type, the technique and the BioProject in the defline of the fasta file. Your fasta should lok like that:

>contig01256 [tech=TSA] [moltype=mRNA] [bioproject=PRJNA159263]
CGTCGTGACCTTGGCTGTCACTCAACCTCTCAATGTAGCAGCCCACTGACGAGAAAGCAA
CATACCACAAGTATCAAGAACATCTATAACTATCACATCCATGGTCAAATGGATATCCGG
ATACATTGATAAGCTGACTTGAAGGTTCAAGATTACTCCTACCACATCAATTTCTCTTGA
ATCCATGGCACAAACATTGT
>contig12463 [tech=TSA] [moltype=mRNA] [bioproject=PRJNA159263]
ATGTGGAAAAAGCAACTGCGGCAGGGTTGGATGCAATCATTATTAAAGGTGTTGAAGTAG
GTGGTTATGTCATTCCCAAGGTTGAAaGGaTAGATTACCCATTTTAAAAaCGtGGAGAAG
TAATCTAGCCTATTGTATGTAAGAaTATATACTAATAAaGGATTgaCAAGAaGTGTAGAG
CCGaCcAACATGGAATCTAT

regards,

anna

[susanklein]

This problem is still going on. I have it now and followed your advice but it did not work... e.g.

tbl2asn -p 2882.fsa -t template.sbt -a s -j "[organism=Listeria monocytogenes]" -w comment.txt -y "[tech=MiSeq] [moltype=DNA] [bioproject=PRJNA320339]" -j "[organism=Listeria monocytogenes] [strain=2882.fsa]"

[tbl2asn] This copy of tbl2asn is more than a year old. Please download the current version.

But I have the current version from ftp.

S.

[susanklein]

This problem is still going on. I have it now and followed your advice but it did not work... e.g.

tbl2asn -p 2882.fsa -t template.sbt -a s -j "[organism=Listeria monocytogenes]" -w comment.txt -y "[tech=MiSeq] [moltype=DNA] [bioproject=PRJNA320339]" -j "[organism=Listeria monocytogenes] [strain=2882.fsa]"

[tbl2asn] This copy of tbl2asn is more than a year old. Please download the current version.

But I have the current version from ftp.

edit> I ahve realised that the command only accepts a folder of sequences for -p, not a single file.. put you data for each sample in a separate folder.

S.