Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Problems about the Trimmomatic on bisulfite sequencing data sets

    Hi, All,

    I have some problems about using Trimmomatic on bisulfite sequencing data sets.


    For example, I downloaded the raw data of human methylome from Lister et al. 2009 Nature (SRR019072.sra), and got the FASTQ file by the sratoolkit.
    Next, I tried the Trimmomatic to trim the adaptors and other low-quality sequences.

    This is the command I used.
    java -classpath trimmomatic-0.20.jar org.usadellab.trimmomatic.TrimmomaticSE -threads 10 -phred64 SRR019072.fastq SRR019072.trim.fq ILLUMINACLIP:remove_adaptor_PCR.fa:2:40:15 LEADING:2 TRAILING:2 MINLEN:60

    Because they were using the single-end adaptors, the remove_adaptor_PCR.fa file is as follows:
    >Prefix_PCR_PRIMER_SEQUENCE/1
    AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
    >Prefix_PCR_PRIMER_SEQUENCE/2
    CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
    >ADAPTOR_SEQUENCE_B
    ACACTCTTTCCCTACACGACGCTCTTCCGATCT
    >ADAPTOR_SEQUENCE_A
    GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG

    This is the running results:
    ILLUMINACLIP: Using 1 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
    Input Reads: 13074151 Surviving: 4569673 (34.95%) Dropped: 8504478 (65.05%)
    TrimmomaticSE: Completed successfully


    It seems that 65% of reads were dropped.
    Moreover, even 65% reads were dropped, the trimmed results still did not pass the FastQC, especially for the "Per base sequence content" and "Kmer Content".


    Therefore, I need your helps to figure out which parameter I used was not proper? Or the remove_adaptor_PCR.fa is not correct?
    Do we need specific parameters for bisulfite sequencing data?


    Many thanks and best regards,
    Jerry

Latest Articles

Collapse

  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM
  • seqadmin
    Essential Discoveries and Tools in Epitranscriptomics
    by seqadmin




    The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
    04-22-2024, 07:01 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 05-14-2024, 07:03 AM
0 responses
17 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-10-2024, 06:35 AM
0 responses
42 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-09-2024, 02:46 PM
0 responses
50 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-07-2024, 06:57 AM
0 responses
41 views
0 likes
Last Post seqadmin  
Working...
X