Hi, All,
I have some problems about using Trimmomatic on bisulfite sequencing data sets.
For example, I downloaded the raw data of human methylome from Lister et al. 2009 Nature (SRR019072.sra), and got the FASTQ file by the sratoolkit.
Next, I tried the Trimmomatic to trim the adaptors and other low-quality sequences.
This is the command I used.
java -classpath trimmomatic-0.20.jar org.usadellab.trimmomatic.TrimmomaticSE -threads 10 -phred64 SRR019072.fastq SRR019072.trim.fq ILLUMINACLIP:remove_adaptor_PCR.fa:2:40:15 LEADING:2 TRAILING:2 MINLEN:60
Because they were using the single-end adaptors, the remove_adaptor_PCR.fa file is as follows:
>Prefix_PCR_PRIMER_SEQUENCE/1
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Prefix_PCR_PRIMER_SEQUENCE/2
CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
>ADAPTOR_SEQUENCE_B
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
>ADAPTOR_SEQUENCE_A
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
This is the running results:
ILLUMINACLIP: Using 1 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 13074151 Surviving: 4569673 (34.95%) Dropped: 8504478 (65.05%)
TrimmomaticSE: Completed successfully
It seems that 65% of reads were dropped.
Moreover, even 65% reads were dropped, the trimmed results still did not pass the FastQC, especially for the "Per base sequence content" and "Kmer Content".
Therefore, I need your helps to figure out which parameter I used was not proper? Or the remove_adaptor_PCR.fa is not correct?
Do we need specific parameters for bisulfite sequencing data?
Many thanks and best regards,
Jerry
-
The field of immunogenetics explores how genetic variations influence immune responses and susceptibility to disease. In a recent SEQanswers webinar, Oscar Rodriguez, Ph.D., Postdoctoral Researcher at the University of Louisville, and Ruben Martínez Barricarte, Ph.D., Assistant Professor of Medicine at Vanderbilt University, shared recent advancements in immunogenetics. This article discusses their research on genetic variation in antibody loci, antibody production processes,...11-06-2024, 07:24 PM -
Next-generation sequencing (NGS) and quantitative polymerase chain reaction (qPCR) are essential techniques for investigating the genome, transcriptome, and epigenome. In many cases, choosing the appropriate technique is straightforward, but in others, it can be more challenging to determine the most effective option. A simple distinction is that smaller, more focused projects are typically better suited for qPCR, while larger, more complex datasets benefit from NGS. However,...10-18-2024, 07:11 AM