Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Problems about the Trimmomatic on bisulfite sequencing data sets

    Hi, All,

    I have some problems about using Trimmomatic on bisulfite sequencing data sets.


    For example, I downloaded the raw data of human methylome from Lister et al. 2009 Nature (SRR019072.sra), and got the FASTQ file by the sratoolkit.
    Next, I tried the Trimmomatic to trim the adaptors and other low-quality sequences.

    This is the command I used.
    java -classpath trimmomatic-0.20.jar org.usadellab.trimmomatic.TrimmomaticSE -threads 10 -phred64 SRR019072.fastq SRR019072.trim.fq ILLUMINACLIP:remove_adaptor_PCR.fa:2:40:15 LEADING:2 TRAILING:2 MINLEN:60

    Because they were using the single-end adaptors, the remove_adaptor_PCR.fa file is as follows:
    >Prefix_PCR_PRIMER_SEQUENCE/1
    AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
    >Prefix_PCR_PRIMER_SEQUENCE/2
    CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
    >ADAPTOR_SEQUENCE_B
    ACACTCTTTCCCTACACGACGCTCTTCCGATCT
    >ADAPTOR_SEQUENCE_A
    GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG

    This is the running results:
    ILLUMINACLIP: Using 1 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
    Input Reads: 13074151 Surviving: 4569673 (34.95%) Dropped: 8504478 (65.05%)
    TrimmomaticSE: Completed successfully


    It seems that 65% of reads were dropped.
    Moreover, even 65% reads were dropped, the trimmed results still did not pass the FastQC, especially for the "Per base sequence content" and "Kmer Content".


    Therefore, I need your helps to figure out which parameter I used was not proper? Or the remove_adaptor_PCR.fa is not correct?
    Do we need specific parameters for bisulfite sequencing data?


    Many thanks and best regards,
    Jerry

Latest Articles

Collapse

  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM
  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Today, 01:32 PM
0 responses
4 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-24-2024, 07:15 AM
0 responses
198 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 10:28 AM
0 responses
220 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 07:35 AM
0 responses
229 views
0 likes
Last Post seqadmin  
Working...
X