Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • choy
    Member
    • Jul 2009
    • 14

    #16
    TopHat v1.0.12 SAM output question

    I am running TopHat v1.0.12 with 40mer paired-end reads, and am having difficulty interpreting the SAM output file (accepted_hits.sam). Here is an example of a pair of output lines that correspond to the mates of a single paired-end read:

    PATHBIO-SOLEXA2:2:58:734:942#0 145 chr1 554416 255 40M = 3836 0 ATAATACACACCCTCACCACTACAATCTTCCTAGGAACAA _QS_\^H^`W^Z[Ua^``M`^Jb_UNVZ\a`]baaaaV`K NM:i:1

    PATHBIO-SOLEXA2:2:58:734:942#0 97 chrM 3836 255 40M = 554416 0 CCATCATGAACCTTGGCCATAATATGATTTATCTCCACAC `bbbbbbaVX`]aa`Y\X`Y]S_a\a_^XZ_bb`bbaT`` NM:i:1

    My question is regarding the MNRM field (the 7th field, set to '=' here). The SAM format specification states that this field is set to the reference of the mate, and will only be set to '=' if the reference of the query sequence is the same as the reference of the mate sequence. In this case the mates map to different contigs, so why is this field set to '='?

    When computing coverage (as in the coverage.wig file), do you eliminate mate pairs that have an MPOS field (the 8th field) that does not correspond to its mate?

    Also, would it be possible for you to set the ISIZE parameter in the accepted_hits.sam file?

    Thanks very much!

    Comment

    • kch
      Junior Member
      • Jul 2009
      • 9

      #17
      Originally posted by griffon42 View Post

      I'm using version 1.0.10 with the "--solexa1.3-quals" flag...can you (or anyone) confirm that Tophat outputs Phred-scaled (ASCII -33 offset) base quality scores (as described in the SAM specifications)? I seem to be getting impossibly high base qualities which could be contributing to my problems in SNP filtering.

      Thanks.
      I am using TopHat version 1.0.12 and Bowtie version 0.11.3 with the "--solexa1.3-quals" flag as well. Similarly, I'm not sure whether the output in my accepted_hits.sam file is reporting ASCII-33 quality values. For example, in the following output:

      EAS306_9079:7:69:745:1129 0 chr1 1442 1 50M * 0 0 CAGAATTGTACTGTTCTGTATCCCACCAGCAATGTCTAGGAATACCTGTT abbbbbbaabbbaababaabbbbbbbaaaabbbaaabaaaaaaaaaaaaa NM:i:1

      The quality string is the same as my Illumina fastq input file and I expected the quality string to be "BCCCCCCBBCCCBBCBCBBCCCCCCCBBBBCCCBBBCBBBBBBBBBBBBB" (as converted using `maq ill2sanger`).

      Any input would be appreciated, thanks!

      Comment

      • Cole Trapnell
        Senior Member
        • Nov 2008
        • 213

        #18
        This is a bug in 1.0.12, and is fixed in the upcoming 1.0.13. 1.0.12 was simply propogating the unconverted quality scores, where 1.0.13 converts them to Phred-33, as required by the SAM spec.

        Comment

        • b1nu
          Junior Member
          • Feb 2010
          • 2

          #19
          I am using tophat 1.0.13 & bowtie 0.12.2, but still get the error
          "[bam_pileup] fail to read the header: non-exisiting file or wrong format."

          The tophat output does mark the quality scale as 'phred33'.

          Code:
          [Tue Feb 23 13:18:51 2010] Checking reads
          	seed length:	 42bp
          	format:		 fastq
          	quality scale:	 phred33 (default)

          Comment

          • b1nu
            Junior Member
            • Feb 2010
            • 2

            #20
            My bad. Hadn't specified the '-S' option to samtools to indicate that input is in SAM format. Works perfectly now.

            Originally posted by b1nu View Post
            I am using tophat 1.0.13 & bowtie 0.12.2, but still get the error
            "[bam_pileup] fail to read the header: non-exisiting file or wrong format."

            The tophat output does mark the quality scale as 'phred33'.

            Code:
            [Tue Feb 23 13:18:51 2010] Checking reads
            	seed length:	 42bp
            	format:		 fastq
            	quality scale:	 phred33 (default)

            Comment

            • ben.weisburd
              Junior Member
              • Oct 2010
              • 9

              #21
              I was seeing this error also ("Error: Segment join failed with err = 1").
              Turned out the problem was that I was running more than one tophat process simultaneously in the same directory (I wanted to process multiple fastq files in parallel). When I launched the processes in separate directories, everything worked fine.

              -Ben

              Originally posted by iloveneworleans View Post
              I just downloaded the latest Tophat-1.0.10, and found there is an segment join failed error at the last.
              And Tophat cannot generate the output files.
              But the previous version did not have this error.
              Is this a new incompatibility or anything else?

              [Fri Jul 31 13:58:04 2009] Beginning TopHat run (v1.0.10)
              -----------------------------------------------
              [Fri Jul 31 13:58:04 2009] Preparing output location ./tophat_out/
              [Fri Jul 31 13:58:04 2009] Checking for Bowtie index files
              [Fri Jul 31 13:58:04 2009] Checking for reference FASTA file
              [Fri Jul 31 13:58:04 2009] Checking for Bowtie
              Bowtie version: 0.10.0.0
              [Fri Jul 31 13:58:04 2009] Checking reads
              seed length: 50bp
              format: fastq
              quality scale: --phred33-quals
              [Fri Jul 31 13:59:06 2009] Reading known junctions from GFF file
              Splitting reads into 2 segments
              [Fri Jul 31 14:00:21 2009] Mapping reads against h_sapiens_asm with Bowtie
              [Fri Jul 31 14:05:34 2009] Mapping reads against h_sapiens_asm with Bowtie
              [Fri Jul 31 14:10:42 2009] Searching for junctions via segment mapping
              [Fri Jul 31 14:22:10 2009] Retrieving sequences for splices
              [Fri Jul 31 14:24:18 2009] Indexing splices
              Warning: Encountered reference sequence with only gaps
              Warning: Encountered reference sequence with only gaps
              .....

              [Fri Jul 31 14:24:41 2009] Mapping reads against segment_juncs with Bowtie
              [Fri Jul 31 14:26:35 2009] Mapping reads against segment_juncs with Bowtie
              [Fri Jul 31 14:28:30 2009] Joining segment hits
              [FAILED]
              Error: Segment join failed with err = 1

              Comment

              • son_nexg
                Junior Member
                • Jul 2011
                • 8

                #22
                Hi I am experiencing problems using .sam output by Tophat with Cufflink.
                My first question is : What options should I use to generate a .bam file with Tophat ?

                If thats not possible, could someone please help me fix the error I am getting when I try to run Cufflink on the .sam file:

                You are using Cufflinks v1.0.3, which is the most recent release.
                [bam_header_read] EOF marker is absent.
                [bam_header_read] invalid BAM binary header (this is not a BAM file).
                File Sample_1001645_9/accepted_hits.sam doesn't appear to be a valid BAM file, trying SAM...
                [15:21:47] Loading reference annotation.
                [15:21:51] Inspecting reads and determining fragment length distribution.
                > Processing Locus chrY:59330251-59343488 [************************ ] 97%
                Error: this SAM file doesn't appear to be correctly sorted!
                current hit is at chrX:145287, last one was at chrM:16469
                Cufflinks requires that if your file has SQ records in
                the SAM header that they appear in the same order as the chromosomes names
                in the alignments.
                If there are no SQ records in the header, or if the header is missing,
                the alignments must be sorted lexicographically by chromsome
                name and by position.





                I also tried to sort the sam output using samtools but that also gives and error that '@SQ header is missing' hence can not sort it using samtools!!

                Thank you.

                Comment

                • Aman Mahajan
                  Member
                  • Jan 2012
                  • 22

                  #23
                  SAM Format

                  I have converted my alignment file to SAM format using samtools. I am not sure if it is correct. It looks like this. Any idea about it?..Thanks

                  HWI-ST141_0380:5:1101:1213:2108#TGACCA 65 199172 35 30 50M * 0 0 CGTCTATAAACCTCTCACATGCTGGTGGATACTTGGTCATGGAAAAATCC hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh NM:i:2 MD:Z:40C1C7
                  HWI-ST141_0380:5:1101:1176:2150#TGACCA 81 57103 30 30 50M * 0 0 TCTCCGTCGTCGCAGACGAGTTCATGGCCAGGGACATCACATTCGAGAAC

                  Comment

                  Latest Articles

                  Collapse

                  • mylaser
                    Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                    by mylaser
                    Kheloyaar: The Complete Guide to Kheloyaar Loginand Kheloyaar ID
                    The online gaming industry has transformed the way people enjoy digital entertainment. As technology continues to improve, players are looking for platforms that offer convenience, security, and a seamless user experience. Kheloyaarhas gained attention among users who value an easy-to-use platform, quick account access, and a simple registration process.
                    Whether you're exploring Kheloyaar for the first time or want to understand...
                    Today, 09:27 PM
                  • SEQadmin2
                    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                    by SEQadmin2



                    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                    ...
                    Today, 11:10 AM
                  • SEQadmin2
                    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                    by SEQadmin2



                    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                    Yesterday, 05:17 AM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by SEQadmin2, Today, 10:04 AM
                  0 responses
                  8 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, Yesterday, 10:08 AM
                  0 responses
                  7 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-07-2026, 11:05 AM
                  0 responses
                  10 views
                  0 reactions
                  Last Post SEQadmin2  
                  Started by SEQadmin2, 07-02-2026, 11:08 AM
                  0 responses
                  31 views
                  0 reactions
                  Last Post SEQadmin2  
                  Working...