Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • Dario1984
    Senior Member
    • Jun 2011
    • 166

    #1

    Bowtie Mapping Wrong Strand

    Hello,

    I ran bowtie 0.12.7 on a FASTA file of microarray probe sequences using the hg19 index as supplied on the website, and I noticed from manually inputting into BLAT a couple of sequences that sequences mapping to the negative strand map to + strand with BLAT. For the sequences mapping to + strand with bowtie, they map to the + strand with BLAT.

    Can someone check this ? How could it be

    Code:
    bowtie -f -v 0 -m 1 --un probesNotMapping.txt hg19 probeSeqs.txt probesMapped.txt
    e.g.

    Bowtie output :
    - chr16 54901845 AGTATTAAACAAGAATGCACGTAAAGTGTGCAATGCATATAGCAGACAGTCAAGAAATGGTGT

    BLAT output :
    100.0% 16 + 54901846 54901908 63

    For reproducibility, the entire sequences file is here.
  • lpagie
    Junior Member
    • Jan 2010
    • 1

    #2
    bowtie: reads aligned to reverse strand are returned in reverse complement

    just now I thought I had run into the same problem. I was fooled by the fact that the output of bowtie contains the read sequences corresponding to the forward strand. So, when the flag in the SAM output of bowtie places the read on the reverse strand, the reported read sequence will now align on the forward strand.
    Check your fasta file you used for input and my guess is that the reads mapped to the reverse strand by bowtie are reverse complement of the reads in the bowtie output.
    The bowtie manual (http://bowtie-bio.sourceforge.net/bo...tml#sam-output) indeed specifies that reads in SAM output are reverse-complemented in aligned to the reverse strand.

    Ludo

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
      by SEQadmin2



      CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

      Despite this, “CRISPR helped turn genome editing from a specialized technique into
      ...
      07-31-2026, 11:01 AM
    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM
    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, Today, 10:13 AM
    0 responses
    10 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-31-2026, 02:55 AM
    0 responses
    23 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-24-2026, 12:17 PM
    0 responses
    19 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-23-2026, 11:41 AM
    0 responses
    18 views
    0 reactions
    Last Post SEQadmin2  
    Working...